View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18054_high_48 (Length: 317)

Name: NF18054_high_48
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18054_high_48
NF18054_high_48
[»] chr8 (1 HSPs)
chr8 (34-237)||(8943576-8943779)


Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 34 - 237
Target Start/End: Original strand, 8943576 - 8943779
Alignment:
Q  34 atgaaactacaagatcctttatgaaactatttgcaatcattaatgtgtaaaagagtatgttcatgcatattgcataccacaattgatactaaaagcccta 133  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  8943576 atgaaactacaagatcctttatgaaactatttgtaatcattaatgtgtaaaagagtatgttcatgcatattgcataccacaattgatactaacagcccta 8943675  T
Q  134 ccccacataatccatattccatgtttagctctctgcttggttttgttttgtattggtgttggagtaggttttgtattttaagaactctaataatacaaca 233  Q
    |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  8943676 ccccacataatccatattacatgtttagctctctgcttggttttattttgtattggtgtcggagtaggttttgtattttaagaactctaataatacaaca 8943775  T
Q  234 aagt 237  Q
    ||||    
T  8943776 aagt 8943779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University