View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18053_high_28 (Length: 248)

Name: NF18053_high_28
Description: NF18053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18053_high_28
NF18053_high_28
[»] chr5 (1 HSPs)
chr5 (104-229)||(2015482-2015607)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 104 - 229
Target Start/End: Complemental strand, 2015607 - 2015482
Alignment:
Q  104 ccaatgctagatggcaactacatgaaattcgagacatacataataataatactatcttgaaccagcatattaattatagttaacagtaaagtataacccg 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2015607 ccaatgctagatggcaactacatgaaattcgagacatacataataataatactatcttgaaccagcatattaattatagttaacagtaaagtataacccg 2015508  T
Q  204 tatgaaactagtgttcagttaaaacc 229  Q
    ||| ||||||||||||||||||||||    
T  2015507 tattaaactagtgttcagttaaaacc 2015482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University