View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18052_low_10 (Length: 226)

Name: NF18052_low_10
Description: NF18052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18052_low_10
NF18052_low_10
[»] chr7 (2 HSPs)
chr7 (16-148)||(5194606-5194741)
chr7 (142-203)||(5188968-5189029)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 16 - 148
Target Start/End: Complemental strand, 5194741 - 5194606
Alignment:
Q  16 atatggtagggtactttttatattaattttttaaatataacgggaacatcatattttggcactttgtttgccatataatatagatttg----nnnnnnnn 111  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||  ||||||||||||||||||||||||                
T  5194741 atatggtagggtactttttatattaattttctaaatataacgggaacatcatattttggcac-atgtttgccatataatatagatttgtttttttttttt 5194643  T
Q  112 gggatatgaaatatgcttgctagttgctacattttca 148  Q
    |||||||||||||||||||||||||||||||||||||    
T  5194642 gggatatgaaatatgcttgctagttgctacattttca 5194606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 142 - 203
Target Start/End: Complemental strand, 5189029 - 5188968
Alignment:
Q  142 attttcaccctttggctcacttctattttcgcacatgctaactacgcagttttgcagtcttt 203  Q
    |||||||||||||||||||||||||||   |||  |||||||||||||||||||||||||||    
T  5189029 attttcaccctttggctcacttctattgaagcatctgctaactacgcagttttgcagtcttt 5188968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University