View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18047_low_10 (Length: 398)

Name: NF18047_low_10
Description: NF18047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18047_low_10
NF18047_low_10
[»] chr6 (4 HSPs)
chr6 (215-379)||(33704510-33704681)
chr6 (151-194)||(21137494-21137537)
chr6 (151-194)||(33715329-33715372)
chr6 (162-194)||(21313170-21313202)
[»] scaffold0076 (1 HSPs)
scaffold0076 (254-357)||(18622-18726)
[»] scaffold0016 (2 HSPs)
scaffold0016 (62-140)||(46837-46913)
scaffold0016 (151-194)||(46771-46814)


Alignment Details
Target: chr6 (Bit Score: 138; Significance: 5e-72; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 215 - 379
Target Start/End: Original strand, 33704510 - 33704681
Alignment:
Q  215 ggatccgtccctgactctgtctacaatgcccacatggc-------gtagttatccatgtgtgcgtctctcttactcacgtgaacgtttatacagaaattt 307  Q
    ||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33704510 ggatccgtccctgactctgtctacaatgcccacatggcactccccgtagttatccatgtgtgcgtctctcttactcacgtgaacgtttatacagaaattt 33704609  T
Q  308 gattaaaaggactagcttattgtaacggtagtaacatacgagatcaacataaaaggtggagatcccgtaaat 379  Q
    |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||    
T  33704610 gattaaaaggactagcttattgtaacggtagtaacataagtgatcaacataaaaggtggagatcccgtaaat 33704681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 194
Target Start/End: Original strand, 21137494 - 21137537
Alignment:
Q  151 tcatacgcaatagtgaaggtaatttcaaggctttcttttccttc 194  Q
    ||||||||||| ||||||||||||||| |||| |||||||||||    
T  21137494 tcatacgcaattgtgaaggtaatttcatggctgtcttttccttc 21137537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 194
Target Start/End: Original strand, 33715329 - 33715372
Alignment:
Q  151 tcatacgcaatagtgaaggtaatttcaaggctttcttttccttc 194  Q
    ||||||||  |||||||||||||||||||||| |||||||||||    
T  33715329 tcatacgcggtagtgaaggtaatttcaaggctgtcttttccttc 33715372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 194
Target Start/End: Original strand, 21313170 - 21313202
Alignment:
Q  162 agtgaaggtaatttcaaggctttcttttccttc 194  Q
    ||||||||||||||||||||| |||||||||||    
T  21313170 agtgaaggtaatttcaaggctgtcttttccttc 21313202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: scaffold0076
Description:

Target: scaffold0076; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 254 - 357
Target Start/End: Original strand, 18622 - 18726
Alignment:
Q  254 tagttatccatgtgtgcgtctctcttactcacgtgaacgttt-atacagaaatttgattaaaaggactagcttattgtaacggtagtaacatacgagatc 352  Q
    |||||||||||| ||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  18622 tagttatccatgcgtgcgtctctcgtagtcacgtgaacgttttatacagaaatttgattaaaaggactagcttattgtaaaggtagtaacataagagatc 18721  T
Q  353 aacat 357  Q
    |||||    
T  18722 aacat 18726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 140
Target Start/End: Complemental strand, 46913 - 46837
Alignment:
Q  62 ctgcttgtgtctctggcaagataaagccaccagcagattttgtgactcttatctgtgatggcacgtggcgatcgacaga 140  Q
    ||||||| |||||||||| ||||||| | ||||||||||||||| ||||||||| ||||||  | ||||||||||||||    
T  46913 ctgcttgcgtctctggca-gataaagtctccagcagattttgtggctcttatctatgatgg-gcatggcgatcgacaga 46837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 194
Target Start/End: Complemental strand, 46814 - 46771
Alignment:
Q  151 tcatacgcaatagtgaaggtaatttcaaggctttcttttccttc 194  Q
    ||||||||| |||||||| ||||||||||||| |||||||||||    
T  46814 tcatacgcagtagtgaagttaatttcaaggctgtcttttccttc 46771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University