View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18046_low_4 (Length: 330)

Name: NF18046_low_4
Description: NF18046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18046_low_4
NF18046_low_4
[»] chr5 (2 HSPs)
chr5 (12-232)||(19597012-19597232)
chr5 (85-131)||(19597241-19597287)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 232
Target Start/End: Original strand, 19597012 - 19597232
Alignment:
Q  12 gcaaaggctatgaagatttcaactggatcaatgatctgcatattatgttgttcattagattgtgatgctcttcgtaatggtgatgatggtggtgatactg 111  Q
    |||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  19597012 gcaaagactatgaagatttcaattggatcaatgatctgcatattatcttgttcattagattgcgatgctcttcgtaatggtgatgatggtggtgatactg 19597111  T
Q  112 ttggtgatggtgttgatggtcgtcctagtgggtatcttctagggatcactgaatgatatattggtggtgggttcactgaacgaggccatggaggacgaat 211  Q
    ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19597112 ttggtgatggtgttgatggtcgtcctgatgggtatcttctagggatcactgaatgatatattggtggtgggttcactgaacgaggccatggaggacgaat 19597211  T
Q  212 gtgactcgatgaaaaattaga 232  Q
    |||||||||||||||||||||    
T  19597212 gtgactcgatgaaaaattaga 19597232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 85 - 131
Target Start/End: Original strand, 19597241 - 19597287
Alignment:
Q  85 gtaatggtgatgatggtggtgatactgttggtgatggtgttgatggt 131  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  19597241 gtaatggtgatgatggtggtgatactgttggtgatggtgttgatggt 19597287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University