View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1803_low_14 (Length: 308)

Name: NF1803_low_14
Description: NF1803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1803_low_14
NF1803_low_14
[»] chr7 (1 HSPs)
chr7 (142-304)||(35451189-35451350)


Alignment Details
Target: chr7 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 142 - 304
Target Start/End: Complemental strand, 35451350 - 35451189
Alignment:
Q  142 tgttaggcttaagtttgttggggctttcttatacactgtactatatacaacgaccacaacaaaacggtatcagccgtagtgccgttaccattttaaagga 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  35451350 tgttaggcttaagtttgttggggctttcttatacactgtactatatacaacgaccacaacaaaacggtatcagccgtagtgccgttaccgttttaaagga 35451251  T
Q  242 attaatgnnnnnnnntaatcacaaactcaattgagctatgggttaaaagagttggaggttttg 304  Q
    |||||||         ||||||||||||||||||  |||||||||||||||||||||||||||    
T  35451250 attaatgaaaaaaaa-aatcacaaactcaattgatttatgggttaaaagagttggaggttttg 35451189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University