View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18037_low_8 (Length: 430)

Name: NF18037_low_8
Description: NF18037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18037_low_8
NF18037_low_8
[»] chr7 (1 HSPs)
chr7 (304-427)||(5720975-5721101)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 304 - 427
Target Start/End: Complemental strand, 5721101 - 5720975
Alignment:
Q  304 tttggtgctatatcgtactttgctactatagaaattgttttcattttgttaccacattataggtacgaagtttctactacaattt---agtgactaatct 400  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||   ||||||||||||    
T  5721101 tttggtgctatatcatacttcgctactatagaaattgttttcattttgttaccacgttataggtacgaagcttccactacaatttagcagtgactaatct 5721002  T
Q  401 ctgtcaaataatatgttgggcccatat 427  Q
    || ||||||||| ||||||||||||||    
T  5721001 ctatcaaataatttgttgggcccatat 5720975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University