View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18034_low_16 (Length: 256)

Name: NF18034_low_16
Description: NF18034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18034_low_16
NF18034_low_16
[»] chr8 (1 HSPs)
chr8 (41-240)||(31463816-31464014)
[»] chr6 (1 HSPs)
chr6 (61-148)||(10746070-10746157)


Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 41 - 240
Target Start/End: Complemental strand, 31464014 - 31463816
Alignment:
Q  41 cattgtgtttggtggtagaaatgcatcatttaggatgagatgagggaggagaaacatggaagtggcaaagaaggctgtttacatgggaggaggatcttct 140  Q
    ||||||||| ||||||||||||||||||||||||||| |||||||||||| |  | |||||||||| ||||||| ||||||  |||||||||| |||| |    
T  31464014 cattgtgttcggtggtagaaatgcatcatttaggatgggatgagggaggacaggcgtggaagtggcgaagaaggttgtttatgtgggaggagggtcttat 31463915  T
Q  141 taagaactattgnnnnnnngttaaataacactattttgcaggatgatatactcatgactgttggatattgttactcgatccaatcaaatgcttctctgtc 240  Q
    ||||||||  ||       ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31463914 taagaactgatgtttttt-gttaaataacactgttttgcaggatgatatactcatgactgttggatattgttactcgatccaatcaaatgcttctctgtc 31463816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 148
Target Start/End: Complemental strand, 10746157 - 10746070
Alignment:
Q  61 atgcatcatttaggatgagatgagggaggagaaacatggaagtggcaaagaaggctgtttacatgggaggaggatcttcttaagaact 148  Q
    |||||| ||||||| || ||||||||||||||  | ||||||||||  |||||| ||||| ||||||||| ||| ||||||| |||||    
T  10746157 atgcattatttagggtgggatgagggaggagaggcgtggaagtggcgtagaaggttgtttgcatgggaggcggaccttcttaggaact 10746070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University