View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18033_low_34 (Length: 237)

Name: NF18033_low_34
Description: NF18033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18033_low_34
NF18033_low_34
[»] chr1 (1 HSPs)
chr1 (186-219)||(15164748-15164781)


Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 219
Target Start/End: Complemental strand, 15164781 - 15164748
Alignment:
Q  186 aaaagaaacaagagatggaaaagaatgttgatgt 219  Q
    ||||||||||||||||||||||||||||||||||    
T  15164781 aaaagaaacaagagatggaaaagaatgttgatgt 15164748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University