View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1802_low_43 (Length: 242)

Name: NF1802_low_43
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1802_low_43
NF1802_low_43
[»] chr7 (1 HSPs)
chr7 (1-226)||(45816097-45816330)


Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 45816097 - 45816330
Alignment:
Q  1 gattcgatcgaaaagtattcaataataactattgaggatctagtttggtcgacatnnnnnnnnnnnnca-------gtcatattcgctcagcaatcagta 93  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||||||             |       ||||||||||||||||||||||||    
T  45816097 gattcgatcgaaaagtagacaataataactattgaggatctagtttggtcgacataaaaaaaataaaaaataaaaagtcatattcgctcagcaatcagta 45816196  T
Q  94 att-gctaactagttcttgacttcttgctgtccaagggggtcaatatagcaaaattatttagaactaaactggtaatatatcatttttctttctatctaa 192  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45816197 atttgctaactagttcttgacttcttgctgtccaagggggtcaatatagcaaaattatttagaactaaactggtaatatatcatttttctttctatctaa 45816296  T
Q  193 gatgataaaaatcttctaccaaaaatgcatattg 226  Q
    ||||||||||||||||||||||||||||||||||    
T  45816297 gatgataaaaatcttctaccaaaaatgcatattg 45816330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University