View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18028_high_15 (Length: 221)

Name: NF18028_high_15
Description: NF18028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18028_high_15
NF18028_high_15
[»] chr7 (1 HSPs)
chr7 (1-115)||(33272831-33272945)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 33272945 - 33272831
Alignment:
Q  1 gtcacatgtcttgtggacctataaactcactttgtaatattcttctctttcttcatccttatcctctcccttctctaccatatgcctcatgaagactaca 100  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  33272945 gtcacatgtcttgtggacctagaaactcattttgtaatattcttctctttcttcatccttatcctctcccttctcaaccatatgcctcatgaagactaca 33272846  T
Q  101 atgagacttatctgt 115  Q
     ||| ||||||||||    
T  33272845 ttgacacttatctgt 33272831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University