View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18023_low_11 (Length: 276)

Name: NF18023_low_11
Description: NF18023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18023_low_11
NF18023_low_11
[»] chr3 (2 HSPs)
chr3 (88-185)||(51728575-51728672)
chr3 (5-37)||(51728719-51728751)


Alignment Details
Target: chr3 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 88 - 185
Target Start/End: Complemental strand, 51728672 - 51728575
Alignment:
Q  88 ttaccttcgtattgaacaactctagctggaataccgaatgaattaatattttcactatcttcccatcttactttaatcttaatccgataccatctata 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  51728672 ttaccttcgtattgaacaactctagctggaataccgaatgaattaatattttcactatcttcccatcgtactttaatcttaatccgataccatctata 51728575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 51728751 - 51728719
Alignment:
Q  5 aaggtacaggatataagggagtttgattgcttc 37  Q
    |||||||||||||||||||||||||||||||||    
T  51728751 aaggtacaggatataagggagtttgattgcttc 51728719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University