View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18021_high_49 (Length: 206)

Name: NF18021_high_49
Description: NF18021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18021_high_49
NF18021_high_49
[»] chr2 (2 HSPs)
chr2 (108-188)||(41823321-41823401)
chr2 (1-66)||(41823445-41823513)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 108 - 188
Target Start/End: Complemental strand, 41823401 - 41823321
Alignment:
Q  108 cactgtgattgggtgaaggccaaacatcttcacgaaattttaggtactagtcgtagcagtctaagactatagtggaaatta 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41823401 cactgtgattgggtgaaggccaaacatcttcacgaaattttaggtactagtcgtagcagtctaagactatagtggaaatta 41823321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 41823513 - 41823445
Alignment:
Q  1 atataccgtcaccacatacattttgaactag---caattcatggcacagaacaagtaaatgaagatacg 66  Q
    |||||||||||||||||||||||||||||||   ||||||||||||||||| |||||||||||||||||    
T  41823513 atataccgtcaccacatacattttgaactagtagcaattcatggcacagaagaagtaaatgaagatacg 41823445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University