View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18018_low_31 (Length: 221)

Name: NF18018_low_31
Description: NF18018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18018_low_31
NF18018_low_31
[»] chr2 (1 HSPs)
chr2 (13-203)||(28535053-28535243)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 28535053 - 28535243
Alignment:
Q  13 aagaaaatataatgcctgtttatgaaaattatggagcatttgatcaaattgtgtcacttgattgtgatgcttcagcttcttggattccaaatttggttga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28535053 aagaaaatataatgcctgtttatgaaaattatggagcatttgatcaaattgtgtcacttgattgtgatgcttcagcttcttggattccaaatttggttga 28535152  T
Q  113 tcaacaagatttcgctgttccggctttattatcagattgtaaaatgggattttatggtggagggtttcagaatttcaatggtagatataat 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28535153 tcaacaagatttcgctgttccggctttattatcagattgtaaaatgggattttatggtggagggtttcagaatttcaatggtagatataat 28535243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University