View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18018_low_22 (Length: 286)

Name: NF18018_low_22
Description: NF18018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18018_low_22
NF18018_low_22
[»] chr8 (27 HSPs)
chr8 (33-127)||(504127-504221)
chr8 (33-127)||(14547922-14548016)
chr8 (33-127)||(12831047-12831141)
chr8 (33-127)||(15197333-15197427)
chr8 (33-127)||(23122603-23122697)
chr8 (33-127)||(34012302-34012396)
chr8 (33-127)||(37038479-37038573)
chr8 (33-127)||(40423949-40424043)
chr8 (33-127)||(1179946-1180040)
chr8 (33-126)||(5957831-5957924)
chr8 (35-127)||(44507095-44507187)
chr8 (33-127)||(10284637-10284731)
chr8 (33-127)||(15048188-15048281)
chr8 (33-108)||(8841438-8841513)
chr8 (33-122)||(10621093-10621182)
chr8 (33-127)||(43414587-43414681)
chr8 (33-126)||(9122196-9122279)
chr8 (37-127)||(16383377-16383467)
chr8 (38-127)||(17443825-17443914)
chr8 (33-127)||(4854869-4854963)
chr8 (37-127)||(34307216-34307306)
chr8 (44-127)||(14055609-14055692)
chr8 (37-127)||(24307803-24307893)
chr8 (62-127)||(30479509-30479574)
chr8 (64-127)||(24307629-24307692)
chr8 (33-127)||(15258935-15259029)
chr8 (33-127)||(42221515-42221609)
[»] chr5 (24 HSPs)
chr5 (33-127)||(36732948-36733042)
chr5 (33-124)||(18520890-18520981)
chr5 (33-127)||(13811652-13811746)
chr5 (33-127)||(2740274-2740368)
chr5 (33-127)||(40145407-40145501)
chr5 (33-127)||(14831814-14831908)
chr5 (33-127)||(33149644-33149738)
chr5 (33-127)||(35785199-35785293)
chr5 (33-127)||(42414308-42414402)
chr5 (33-127)||(35943898-35943992)
chr5 (33-127)||(28177775-28177869)
chr5 (33-127)||(6679698-6679792)
chr5 (33-127)||(15409616-15409710)
chr5 (36-127)||(41470425-41470516)
chr5 (37-127)||(3921275-3921365)
chr5 (33-127)||(26720516-26720610)
chr5 (33-127)||(26990265-26990359)
chr5 (33-83)||(31009032-31009082)
chr5 (68-126)||(36875644-36875702)
chr5 (35-78)||(31132393-31132436)
chr5 (37-127)||(2252178-2252268)
chr5 (33-127)||(20073522-20073616)
chr5 (33-83)||(21370048-21370098)
chr5 (59-127)||(33825356-33825424)
[»] chr3 (30 HSPs)
chr3 (33-127)||(53982011-53982105)
chr3 (33-127)||(33644200-33644294)
chr3 (33-127)||(49607414-49607508)
chr3 (33-127)||(54868901-54868995)
chr3 (33-122)||(52629305-52629394)
chr3 (33-127)||(8076393-8076487)
chr3 (33-127)||(17470405-17470499)
chr3 (33-127)||(27714897-27714991)
chr3 (33-126)||(31456690-31456783)
chr3 (51-127)||(11095377-11095453)
chr3 (33-127)||(26141538-26141632)
chr3 (37-123)||(48587101-48587187)
chr3 (33-116)||(26754706-26754789)
chr3 (48-127)||(33118872-33118951)
chr3 (42-127)||(36707439-36707524)
chr3 (33-127)||(20764921-20765015)
chr3 (33-127)||(35536626-35536720)
chr3 (33-127)||(41189770-41189864)
chr3 (33-127)||(11907371-11907465)
chr3 (33-127)||(14623845-14623939)
chr3 (45-127)||(24699972-24700054)
chr3 (33-123)||(30801739-30801829)
chr3 (33-127)||(11347928-11348022)
chr3 (33-127)||(51419366-51419460)
chr3 (33-126)||(13898061-13898154)
chr3 (33-127)||(9562999-9563093)
chr3 (45-127)||(41080709-41080790)
chr3 (33-127)||(47531865-47531959)
chr3 (37-127)||(45058563-45058652)
chr3 (37-105)||(36331339-36331407)
[»] chr1 (29 HSPs)
chr1 (33-127)||(2581915-2582009)
chr1 (33-127)||(48716288-48716382)
chr1 (33-127)||(9474882-9474976)
chr1 (33-127)||(3000319-3000413)
chr1 (33-127)||(8346394-8346488)
chr1 (33-127)||(27564741-27564835)
chr1 (33-127)||(38632327-38632421)
chr1 (33-124)||(44548382-44548473)
chr1 (33-127)||(38595154-38595248)
chr1 (33-127)||(47452326-47452420)
chr1 (33-127)||(51898689-51898783)
chr1 (33-127)||(50630458-50630552)
chr1 (33-127)||(32813247-32813341)
chr1 (33-127)||(43132-43226)
chr1 (33-127)||(41758805-41758899)
chr1 (34-126)||(11152385-11152476)
chr1 (33-127)||(37649198-37649292)
chr1 (33-97)||(13414791-13414855)
chr1 (37-124)||(26274435-26274522)
chr1 (33-107)||(45044566-45044640)
chr1 (37-127)||(5959010-5959100)
chr1 (33-115)||(49811533-49811615)
chr1 (37-127)||(50591010-50591100)
chr1 (37-127)||(41608503-41608593)
chr1 (33-127)||(23597097-23597191)
chr1 (33-115)||(26440746-26440828)
chr1 (33-122)||(44453984-44454073)
chr1 (33-78)||(48489349-48489394)
chr1 (33-78)||(44334176-44334221)
[»] chr2 (32 HSPs)
chr2 (33-124)||(28863458-28863549)
chr2 (33-127)||(9058480-9058574)
chr2 (33-127)||(10249388-10249482)
chr2 (33-127)||(32505654-32505748)
chr2 (33-127)||(33436106-33436200)
chr2 (33-127)||(7465741-7465835)
chr2 (33-127)||(13438343-13438437)
chr2 (33-127)||(17473020-17473114)
chr2 (33-127)||(40701478-40701572)
chr2 (33-127)||(5574494-5574588)
chr2 (33-127)||(28381661-28381755)
chr2 (33-127)||(30915463-30915557)
chr2 (33-124)||(19930826-19930917)
chr2 (33-127)||(27864704-27864798)
chr2 (33-127)||(4060685-4060779)
chr2 (33-127)||(20700815-20700909)
chr2 (33-127)||(40613908-40614002)
chr2 (44-127)||(38882831-38882913)
chr2 (33-127)||(42257193-42257287)
chr2 (33-127)||(2533124-2533217)
chr2 (33-127)||(26891510-26891604)
chr2 (33-127)||(38273148-38273242)
chr2 (59-127)||(33436211-33436279)
chr2 (33-127)||(17820010-17820104)
chr2 (44-126)||(41575138-41575220)
chr2 (37-127)||(43490121-43490211)
chr2 (33-114)||(3439992-3440073)
chr2 (37-109)||(2997497-2997569)
chr2 (33-84)||(3737986-3738037)
chr2 (37-127)||(38732354-38732444)
chr2 (35-127)||(36168836-36168928)
chr2 (37-127)||(45097745-45097835)
[»] chr7 (32 HSPs)
chr7 (33-127)||(7389389-7389483)
chr7 (33-127)||(8080389-8080483)
chr7 (33-127)||(19329842-19329936)
chr7 (33-127)||(36361919-36362013)
chr7 (33-127)||(38267040-38267134)
chr7 (33-124)||(3783998-3784089)
chr7 (33-127)||(3434562-3434656)
chr7 (33-127)||(4999520-4999614)
chr7 (33-127)||(35137533-35137627)
chr7 (33-127)||(36362026-36362120)
chr7 (33-127)||(38837217-38837311)
chr7 (33-127)||(19436193-19436287)
chr7 (33-127)||(40957707-40957801)
chr7 (33-127)||(21234401-21234495)
chr7 (33-124)||(3694370-3694461)
chr7 (33-127)||(46374808-46374902)
chr7 (33-126)||(32951499-32951592)
chr7 (37-127)||(8238212-8238303)
chr7 (33-122)||(35522881-35522970)
chr7 (33-127)||(36208173-36208267)
chr7 (37-127)||(38044197-38044287)
chr7 (37-127)||(7727906-7727996)
chr7 (61-127)||(10343597-10343663)
chr7 (37-127)||(22343361-22343451)
chr7 (37-127)||(39255934-39256023)
chr7 (37-127)||(41915741-41915831)
chr7 (35-127)||(46033809-46033901)
chr7 (37-127)||(11044188-11044268)
chr7 (38-127)||(40846124-40846213)
chr7 (35-127)||(41423682-41423774)
chr7 (33-78)||(16374830-16374875)
chr7 (62-127)||(32564461-32564526)
[»] chr6 (18 HSPs)
chr6 (33-127)||(6209471-6209565)
chr6 (33-127)||(32869678-32869772)
chr6 (33-124)||(22880664-22880755)
chr6 (33-127)||(17598554-17598648)
chr6 (33-127)||(11427616-11427712)
chr6 (33-127)||(29857827-29857921)
chr6 (41-115)||(31109414-31109488)
chr6 (33-127)||(31976248-31976342)
chr6 (38-127)||(15832577-15832666)
chr6 (33-127)||(31110767-31110859)
chr6 (33-96)||(23128133-23128196)
chr6 (37-127)||(15508034-15508124)
chr6 (37-127)||(15990052-15990142)
chr6 (37-127)||(30341370-30341460)
chr6 (33-123)||(28536494-28536582)
chr6 (33-127)||(31953036-31953130)
chr6 (37-105)||(4231570-4231638)
chr6 (51-126)||(946377-946452)
[»] chr4 (31 HSPs)
chr4 (33-127)||(11511468-11511562)
chr4 (33-127)||(41236347-41236441)
chr4 (33-127)||(48183055-48183149)
chr4 (33-127)||(50052434-50052528)
chr4 (33-127)||(54473539-54473633)
chr4 (33-127)||(480453-480547)
chr4 (33-127)||(6034044-6034138)
chr4 (33-127)||(29239886-29239980)
chr4 (33-127)||(42044373-42044467)
chr4 (33-127)||(3481654-3481748)
chr4 (33-127)||(29234251-29234345)
chr4 (33-127)||(23608235-23608329)
chr4 (33-127)||(24995113-24995207)
chr4 (34-127)||(50526178-50526271)
chr4 (33-127)||(31910192-31910286)
chr4 (37-127)||(19670726-19670816)
chr4 (35-122)||(53352574-53352660)
chr4 (33-127)||(29977885-29977979)
chr4 (33-83)||(41823926-41823976)
chr4 (33-127)||(48647732-48647826)
chr4 (33-117)||(28480274-28480358)
chr4 (33-117)||(28481149-28481233)
chr4 (33-117)||(28482024-28482108)
chr4 (60-127)||(40574779-40574846)
chr4 (62-127)||(55475191-55475256)
chr4 (37-109)||(17983753-17983825)
chr4 (37-127)||(47986208-47986298)
chr4 (37-127)||(50813902-50813992)
chr4 (62-127)||(55079749-55079814)
chr4 (37-127)||(32766958-32767048)
chr4 (62-127)||(29547994-29548059)
[»] scaffold0237 (1 HSPs)
scaffold0237 (33-127)||(4029-4123)
[»] scaffold1268 (1 HSPs)
scaffold1268 (33-127)||(935-1029)
[»] scaffold1267 (1 HSPs)
scaffold1267 (33-127)||(935-1029)
[»] scaffold0321 (1 HSPs)
scaffold0321 (33-127)||(10115-10209)
[»] scaffold0110 (1 HSPs)
scaffold0110 (37-115)||(8873-8951)
[»] scaffold0316 (1 HSPs)
scaffold0316 (33-78)||(17103-17148)
[»] scaffold0018 (1 HSPs)
scaffold0018 (38-111)||(152514-152587)


Alignment Details
Target: chr8 (Bit Score: 79; Significance: 6e-37; HSPs: 27)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 504127 - 504221
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  504127 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgccacctaagggtgtctatgtatcattactc 504221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 14548016 - 14547922
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| || ||||||    
T  14548016 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaatggtgtattgccacctaagggtgtctatgtatctttactc 14547922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 12831141 - 12831047
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||  |||||||||||||||||| |||||||||    
T  12831141 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgtcacctaagggtgtctatgtatcattactc 12831047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 15197427 - 15197333
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||| |||||||||| |||||||||    
T  15197427 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagagtgtctatgtatcattactc 15197333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 23122603 - 23122697
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| || ||||||||||||||| |||||||||    
T  23122603 tgtgcttatgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgccacttaagggtgtctatgtatcattactc 23122697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 34012302 - 34012396
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||||||||| ||||||||||| |||||||| |||||||| | |||||||||||||||||| |||||||||    
T  34012302 tgtgcttgtgcgggatccacgtgactacgtgtcaaatttttgtgtgggtgtcaaagggtgtattaccacctaagggtgtctatgtatcattactc 34012396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 37038573 - 37038479
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||| | ||||||||| |||||||||    
T  37038573 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaagatgtctatgtatcattactc 37038479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 40423949 - 40424043
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||| |||||||||||||||||||||||||  ||||||| |||||||||| |||||||||| ||||||| |||||||||    
T  40423949 tgtgcttgtgcggggtccacatgactacgtgtcagatttttgtgtggatgtcaaagggtgtattgccacctaagggtatctatgtatcattactc 40424043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 1179946 - 1180040
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||  ||||| ||||||||||||||||||||||||| |||||||| |||||||| | |||||||||||||||||| |||||||||    
T  1179946 tgtgcttgtgcggaatccacatgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattaccacctaagggtgtctatgtatcattactc 1180040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 5957924 - 5957831
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    |||| ||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||  ||||||||| ||||||||    
T  5957924 tgtgattgtgcgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagaatgtctatgtatcattact 5957831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 35 - 127
Target Start/End: Original strand, 44507095 - 44507187
Alignment:
Q  35 tgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||||||||||||||||||||||||||||||||| |||| |||  ||||||| | |||||||||||||||||| |||||||||    
T  44507095 tgcttgtacggggtccacgtgactacgtgtcagatttttgtgtgggtgttaaagagtgtattaccacctaagggtgtctatgtatcattactc 44507187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 10284637 - 10284731
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||  ||||||||  || ||||||||||||||| |||| ||||    
T  10284637 tgtgcttgtgcggggtccacgtgactacgtgtcaaatttttgtgtgggtgtcaaagagtgtattgtcacttaagggtgtctatgtatcataactc 10284731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 15048188 - 15048281
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||| |||||||| |||||||||| |||||||| ||||||||| |||| ||||    
T  15048188 tgtgcttgtgcggggtccatgtggctacgtgtcagatttttgtgtg-gtgtcaaagggtgtattgccacctaaggatgtctatgtatcataactc 15048281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 33 - 108
Target Start/End: Original strand, 8841438 - 8841513
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaaggg 108  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||| ||| |||||||||    
T  8841438 tgtgcttgtgcggggtccacgtgactacgtgttagatttttgtgtgggtgtcaaagggtgtactgccacctaaggg 8841513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 122
Target Start/End: Original strand, 10621093 - 10621182
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcat 122  Q
    |||||||||||||| || | ||| |||||||||||||||||||||| |||||||| |||||||| | |||||||| ||||||||| ||||    
T  10621093 tgtgcttgtgcgggatcgatgtggctacgtgtcagatttttgtgtgggtgtcaaagggtgtattaccacctaaggatgtctatgtatcat 10621182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 43414587 - 43414681
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| |||| ||||| |||||| ||||||||||||| |||||||| ||||| |||| | |||||| ||||||||| |||| ||||    
T  43414587 tgtgcttgtgcgggatccatgtgaccacgtgttagatttttgtgtgggtgtcaaagggtgtgttgccatctaaggatgtctatgtatcataactc 43414681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 9122279 - 9122196
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    |||||||||||||| ||||||||||||| |||||||||||||||||          |||||||||| |||||||||||||||||| ||||||||    
T  9122279 tgtgcttgtgcgggatccacgtgactacatgtcagatttttgtgtg----------ggtgtattgccacctaagggtgtctatgtatcattact 9122196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 16383467 - 16383377
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  16383467 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 16383377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 38 - 127
Target Start/End: Complemental strand, 17443914 - 17443825
Alignment:
Q  38 ttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||| ||||||||| ||||||| |||||||||||||||||||||| ||   ||||||||  |||||||| ||||||||| |||| ||||    
T  17443914 ttgtgtggggtccacatgactacatgtcagatttttgtgtgagtgttaagaagtgtattgtcacctaaggttgtctatgtatcataactc 17443825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 4854869 - 4854963
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||| ||||||| ||| | || | |||||||||| |||  |||| ||| |||||||||| |||||||| ||||||||| |||||||||    
T  4854869 tgtgcttgtgcagggtccatgtggccacatatcagatttttatgtaggtgttaaagggtgtattgccacctaaggatgtctatgtatcattactc 4854963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 34307306 - 34307216
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||| ||  || | || ||||||||||||||||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  34307306 cttgtgcggggttcatatgtccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 34307216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 127
Target Start/End: Original strand, 14055609 - 14055692
Alignment:
Q  44 ggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||| ||| |||||||||||||  ||||||   ||||||||  ||||||||||||| |||| |||| ||||    
T  14055609 ggggtccacgtgactacatgtaagatttttgtgtggatgtcaaggagtgtattgtcacctaagggtgtcaatgtatcataactc 14055692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 24307803 - 24307893
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || | ||||||||||||||| |||||||  | |||||||| |||||||||||| ||||| |||| ||||    
T  24307803 cttgtgcggggtccatatggccacatatcagatttttgtgtgggtgtcaagggatgtattgccacctaagggtgtttatgtatcataactc 24307893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 62 - 127
Target Start/End: Original strand, 30479509 - 30479574
Alignment:
Q  62 tgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||| ||||  ||||||| |||||||||| |||||||||||| ||||| |||| ||||    
T  30479509 tgtcagatttttatgtggatgtcaaagggtgtattgccacctaagggtgtttatgtatcataactc 30479574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 64 - 127
Target Start/End: Complemental strand, 24307692 - 24307629
Alignment:
Q  64 tcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||| |||||||  | |||||||| |||||||||||| ||||| |||| ||||    
T  24307692 tcagatttttgtgtgggtgtcaatggatgtattgccacctaagggtgtttatgtatcataactc 24307629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 15258935 - 15259029
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||| ||||||||||||| || |||||||||||| ||||  |||| |  | |||||||| | ||||| || ||||||| |||| ||||    
T  15258935 tgtgcttgtgcagggtccacgtgaccacatgtcagatttttatgtggatgtccagggatgtattgccatctaagagtatctatgtatcataactc 15259029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 42221609 - 42221515
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||  ||||||||  ||| ||||||||||||||||||||| ||||| |    |||||||  |||||||| ||| ||||| |||||||||    
T  42221609 tgtgcttgtatggggtccatatgattacgtgtcagatttttgtgtgggtgtccaggaatgtattgtcacctaaggatgtatatgtatcattactc 42221515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 79; Significance: 6e-37; HSPs: 24)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 36732948 - 36733042
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||    
T  36732948 tgtgcttgtgcggggtccacgtgactatgtgtcagatttttgtgtgggtgtcaaagggtgtattgctacctaagggtgtctatgtatcattactc 36733042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 33 - 124
Target Start/End: Original strand, 18520890 - 18520981
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatta 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| ||||||    
T  18520890 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcatta 18520981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 13811746 - 13811652
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||| || ||||||    
T  13811746 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaatgatgtattgccacctaagggtgtctatgtatctttactc 13811652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 2740368 - 2740274
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||| ||||||||| |||||||||    
T  2740368 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaggatgtctatgtatcattactc 2740274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 40145501 - 40145407
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  ||| ||| |||||||||| |||||||||||||||||| |||||||||    
T  40145501 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtggatgttaaagggtgtattgccacctaagggtgtctatgtatcattactc 40145407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 14831908 - 14831814
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| |||||||||||||||||||||||||| |||| |||||||| |||||||||| ||||||| |||||||||| |||||||||    
T  14831908 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttatgtgggtgtcaaagggtgtattgccacctaagagtgtctatgtatcattactc 14831814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 33149644 - 33149738
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||||||||| ||||||||||| |||||||| |||||||| | |||||||||||||||||| |||||||||    
T  33149644 tgtgcttgtgcgggatccacgtgactacgtgtcaaatttttgtgtgggtgtcaaagggtgtattaccacctaagggtgtctatgtatcattactc 33149738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 35785293 - 35785199
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||||||| ||||||| ||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  35785293 tgtgattgtgcgggatccacgtaactacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgccacctaagggtgtctatgtatcattactc 35785199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 42414308 - 42414402
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||| |||||  ||||||||||| |||||||||    
T  42414308 tgtgcttgtgcggggtccacatgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctactggtgtctatgtatcattactc 42414402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 35943898 - 35943992
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| ||| ||||||| ||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||| |||| ||||    
T  35943898 tgtgcttgtgtgggatccacgtaactacgtgtcagatttttgtgtgggtgtcaaatgatgtattgccacctaagggtgtctatgtatcataactc 35943992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 28177869 - 28177775
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| |||||||||||||| ||||| |||||||||||||||||||| |||||||| |||||||||| |||||||| ||||||||| |||| ||||    
T  28177869 tgtgtttgtgcggggtccatgtgaccacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaggatgtctatgtatcataactc 28177775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 6679792 - 6679698
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| |||||||||||||| ||||| |||||||||||||||||||| |||||||| |||||||||| |||||| | ||||||||| |||| ||||    
T  6679792 tgtgtttgtgcggggtccatgtgaccacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgccacctaaagatgtctatgtatcataactc 6679698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 15409616 - 15409710
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||   |||||||  |||||||| ||||||||| |||| ||||    
T  15409616 tgtgcttgtgcggggtccatgtggctacgtgtcagatttttgtgtgggtgtcaaagaatgtattgtcacctaaggatgtctatgtatcataactc 15409710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 36 - 127
Target Start/End: Original strand, 41470425 - 41470516
Alignment:
Q  36 gcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||| | ||| | | ||| | |||||||| |||||| ||||||||||| | |||||||    
T  41470425 gcttgtgcggggtccacgtgactacgtgtcagatttttatatgaattttaaaggatgtattgccacctaaaggtgtctatgtattattactc 41470516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 3921275 - 3921365
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  3921275 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 3921365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 26720610 - 26720516
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| |||| ||| | ||||||||||||||| |||  |||| ||| |||||||||| |||||||| ||||||||| |||| ||||    
T  26720610 tgtgcttgtgcgggatccatgtggccacgtgtcagatttttttgtaggtgttaaagggtgtattgccacctaaggatgtctatgtatcataactc 26720516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 26990359 - 26990265
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| |||| ||| | ||||||||||||||| |||  |||| ||| |||||||||| |||||||| ||||||||| |||| ||||    
T  26990359 tgtgcttgtgcgggatccatgtggccacgtgtcagatttttttgtaggtgttaaagggtgtattgccacctaaggatgtctatgtatcataactc 26990265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 31009082 - 31009032
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgt 83  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| ||||    
T  31009082 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttgtgtgggtgt 31009032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 68 - 126
Target Start/End: Original strand, 36875644 - 36875702
Alignment:
Q  68 atttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    ||||||||||| |||||||| |||||||||| |||||||||||||||||| ||||||||    
T  36875644 atttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattact 36875702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 35 - 78
Target Start/End: Complemental strand, 31132436 - 31132393
Alignment:
Q  35 tgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtg 78  Q
    |||||||||||||||||||||||||| |||||||||||||||||    
T  31132436 tgcttgtgcggggtccacgtgactacttgtcagatttttgtgtg 31132393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 2252178 - 2252268
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| |||||||| ||| ||||| |||| ||||    
T  2252178 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaaggatgtttatgtatcataactc 2252268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 20073522 - 20073616
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||| |||||||||||   |||||  |||||||| ||||||||||||| |||||||||  | |||| | ||||||| | |||||||||    
T  20073522 tgtgcttgtgcagggtccacgtggtcacgtgcaagatttttatgtgagtgtcaaagggtgtattgtcatctaatgatgtctatatatcattactc 20073616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 21370098 - 21370048
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgt 83  Q
    |||| |||||||||||||||||||| || ||||||||||||| ||| ||||    
T  21370098 tgtgtttgtgcggggtccacgtgaccacatgtcagatttttgagtgggtgt 21370048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 127
Target Start/End: Original strand, 33825356 - 33825424
Alignment:
Q  59 acgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||| |||| |||||||   ||||||||| |||||||  ||||||||  |||||||||    
T  33825356 acgtgtcagatttttatgtgggtgtcaaggagtgtattgccacctaagaatgtctatgcatcattactc 33825424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 30)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 53982105 - 53982011
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  53982105 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 53982011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 33644294 - 33644200
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||| |||||||||||||| |||||||||    
T  33644294 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacccaagggtgtctatgtatcattactc 33644200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 49607508 - 49607414
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| ||| ||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  49607508 tgtgcttgtgtgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 49607414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 54868901 - 54868995
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  54868901 tgtgattgtgcggggtccacgtaactacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgccacctaagggtgtctatgtatcattactc 54868995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 33 - 122
Target Start/End: Complemental strand, 52629394 - 52629305
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcat 122  Q
    ||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| ||||    
T  52629394 tgtgcttgtacggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcat 52629305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 8076487 - 8076393
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||| ||| |||||||||||| ||||| |||||||||    
T  8076487 tgtgcttgtgcggggtccacgtgactacgtgttagatttttgtgtgggtgtcaaagggtgtactgccacctaagggtgtttatgtatcattactc 8076393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 17470499 - 17470405
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||| ||| |||||||||| |||||| ||||||||||| |||||||||    
T  17470499 tgtgcttgtgtggggtccacgtgactacgtgtcagatttttgtgtgggtgttaaaaggtgtattgccacctaaaggtgtctatgtatcattactc 17470405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 27714897 - 27714991
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||| | |||||| ||||||||||| |||||||||    
T  27714897 tgtgcttgtgcggggtccacatgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattaccacctaaaggtgtctatgtatcattactc 27714991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 31456783 - 31456690
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||  |||| |||||||||||| ||||||||    
T  31456783 tgtgcttgtgcggggtccacatgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccgcctatgggtgtctatgtatcattact 31456690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 51 - 127
Target Start/End: Original strand, 11095377 - 11095453
Alignment:
Q  51 acgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  11095377 acgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 11095453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 26141538 - 26141632
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| |||||||| ||||| |||||||||||||||||||| |||| ||| |||||||||| |||||||| ||||||||| |||| ||||    
T  26141538 tgtgcttgtgtggggtccatgtgaccacgtgtcagatttttgtgtgggtgttaaagggtgtattgccacctaaggatgtctatgtatcataactc 26141632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 37 - 123
Target Start/End: Original strand, 48587101 - 48587187
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatt 123  Q
    |||||||||| |||||||||||||||||||||||||| |||  |||||||| |||||||||| |||||||||| ||||||| |||||    
T  48587101 cttgtgcgggatccacgtgactacgtgtcagatttttatgtaggtgtcaaagggtgtattgccacctaagggtatctatgtatcatt 48587187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 26754789 - 26754706
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatg 116  Q
    ||||||||||||||||||| ||||| || |||||||||||||||||  |||| || |||||||||| |||||||||||||||||    
T  26754789 tgtgcttgtgcggggtccatgtgaccacatgtcagatttttgtgtggatgtccaagggtgtattgccacctaagggtgtctatg 26754706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 48 - 127
Target Start/End: Original strand, 33118872 - 33118951
Alignment:
Q  48 tccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||||||||||| |||||||| |||||||||  |||||||||||||||||| |||| ||||    
T  33118872 tccacgtgactacgtgtcaaatttttgtgtgggtgtcaaagggtgtattgtcacctaagggtgtctatgtatcataactc 33118951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 42 - 127
Target Start/End: Original strand, 36707439 - 36707524
Alignment:
Q  42 gcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||| ||||||| |||||||||||||||||||||||  ||||||| |||||||||  |||||||||| ||||||| |||||||||    
T  36707439 gcgggatccacgtaactacgtgtcagatttttgtgtggatgtcaaagggtgtattgtcacctaagggtatctatgtatcattactc 36707524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 20764921 - 20765015
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||| ||||||||| ||| | |||||||||||||||||||| |||| |||  ||||||| | |||||||| |||||||||||||| ||||    
T  20764921 tgtgcttgtacggggtccatgtggccacgtgtcagatttttgtgtgggtgttaaagagtgtattaccacctaaggatgtctatgtctcataactc 20765015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 35536720 - 35536626
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||   ||||||| |||| |||||||| |||||| |||| ||||||||||||||||||| || ||||| ||||||||| |||||||||    
T  35536720 tgtgcttgtgtaaggtccacatgaccacgtgtcacatttttatgtgggtgtcaaatggtgtattgccacataaggatgtctatgtatcattactc 35536626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 41189770 - 41189864
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||| | |||||||| |||||| |||| |||||||||| |||||||| |||||||| ||| ||||| |||| ||||    
T  41189770 tgtgcttgtgcggggtccatgtggccacgtgtcaaatttttatgtgggtgtcaaatgatgtattgccacctaaggatgtatatgtatcataactc 41189864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 11907465 - 11907371
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||  |||| || ||||||||||||||||||||||  |   ||||||||  |||||||||||||||||| |||| ||||    
T  11907465 tgtgcttgtgcggggtccatatgaccacatgtcagatttttgtgtgagtgttcaggtgtgtattgtcacctaagggtgtctatgtatcataactc 11907371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 14623845 - 14623939
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| | ||||||| |||  || |||||||||||| |||| |||||||  |||||||||| |||||||| ||||||||| |||||||||    
T  14623845 tgtgcttgtgtgaggtccacatgaacacatgtcagatttttatgtgggtgtcaaggggtgtattgccacctaaggatgtctatgtatcattactc 14623939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 45 - 127
Target Start/End: Original strand, 24699972 - 24700054
Alignment:
Q  45 gggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||| | ||||| ||||||||| |||| |||||||| |||||||||| | |||||| ||||||||| |||||||||    
T  24699972 gggtccacgtggccacgtgccagatttttatgtgggtgtcaaaaggtgtattgccaactaaggatgtctatgtatcattactc 24700054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 123
Target Start/End: Original strand, 30801739 - 30801829
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatt 123  Q
    |||||||||| ||||||||  ||||||| ||||| ||||||||||| || ||||| ||||||||   |||||||||||||||||| |||||    
T  30801739 tgtgcttgtgtggggtccatatgactacatgtcatatttttgtgtgggtatcaaagggtgtattatcacctaagggtgtctatgtatcatt 30801829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 11347928 - 11348022
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| ||| ||||||| ||| | ||||||||||||||||||||  ||||||| | |||||||  |||||||| ||||||||| |||| ||||    
T  11347928 tgtgcttatgcagggtccatgtggccacgtgtcagatttttgtgtggatgtcaaaggatgtattgtcacctaaggatgtctatgtatcataactc 11348022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 51419366 - 51419460
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||| | ||| | |||||||||||||||||||| |||| ||| | |||||||  | |||||| ||||||||| |||| ||||    
T  51419366 tgtgcttgtgcggggtctatgtggccacgtgtcagatttttgtgtgggtgttaaaggatgtattgtcatctaaggatgtctatgtatcataactc 51419460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 126
Target Start/End: Original strand, 13898061 - 13898154
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    |||||||||| | ||||||| |||  ||||||||||||||| |||| |||||||  |||||||||| |||||||| ||| ||| | ||||||||    
T  13898061 tgtgcttgtgtgaggtccacatgaacacgtgtcagatttttatgtgggtgtcaaggggtgtattgccacctaaggatgtttatctatcattact 13898154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 9563093 - 9562999
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| |||||| || |||||||||||||||||||||||||| | ||  ||||||| | |||||||  | |||| ||||| ||||| |||||||||    
T  9563093 tgtgtttgtgcaggatccacgtgactacgtgtcagatttttatatggatgtcaaaggttgtattgtcatctaatggtgtttatgtatcattactc 9562999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 127
Target Start/End: Complemental strand, 41080790 - 41080709
Alignment:
Q  45 gggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||| |||| || | ||||||||||| ||| |||||||| ||||| |||||| |||||| ||||||||| |||||||||    
T  41080790 gggtccacatgaccacatatcagatttttgcgtgggtgtcaaagggtgttttgcta-ctaaggatgtctatgtatcattactc 41080709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 47531959 - 47531865
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||| ||  || | |||||||||||| |||||||  ||| ||| |||||||||| | |||||| ||||||||| |||| ||||    
T  47531959 tgtgcttgtgcggggttcatatggccacgtgtcagattcttgtgtggatgttaaaaggtgtattgccatctaaggatgtctatgtatcataactc 47531865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 45058563 - 45058652
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  ||   || |||||||||||| |||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  45058563 cttgtgcggggtccatatggtcacatgtcagatttttatgtgggtgtcaag-ggtgtattgccacctaagggtgtttatgtatcataactc 45058652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 37 - 105
Target Start/End: Original strand, 36331339 - 36331407
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaa 105  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||| ||||| ||||||    
T  36331339 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgcattgccacctaa 36331407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 79; Significance: 6e-37; HSPs: 29)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 2582009 - 2581915
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  2582009 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 2581915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 48716288 - 48716382
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| |||||||||||||||||| |||||||||    
T  48716288 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtggatgtcaaatggtgtattgccacctaagggtgtctatgtatcattactc 48716382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 9474882 - 9474976
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  9474882 tgtgtttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 9474976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 3000413 - 3000319
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||| ||||| |||||||||    
T  3000413 tgtgcttgtacggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtttatgtatcattactc 3000319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 8346394 - 8346488
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||| |||||| |||||||||    
T  8346394 tgtgcttgtgcagggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaatggtgtattgccacctaaaggtgactatgtatcattactc 8346488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 27564741 - 27564835
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||| |||||||| ||||||||| |||||||||    
T  27564741 tgtgcttgtgcggggtccacgtgattacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgccacctaaggatgtctatgtatcattactc 27564835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 38632327 - 38632421
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  ||| ||| |||||||||| |||||||||||||||||| |||||||||    
T  38632327 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtggatgttaaaaggtgtattgccacctaagggtgtctatgtatcattactc 38632421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 33 - 124
Target Start/End: Original strand, 44548382 - 44548473
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatta 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||| | ||||||||| ||||||    
T  44548382 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtatcaaatggtgtattgccacctaaagatgtctatgtatcatta 44548473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 38595248 - 38595154
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||| ||||| ||||| |||||||||    
T  38595248 tgtgcttgtacggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaaggtgtttatgtatcattactc 38595154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 47452326 - 47452420
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||||||| ||||||||||||| |||||||| |||||||| | |||||||||||||||||| |||||||||    
T  47452326 tgtgcttgtgcgggatccacgtgactacgtgttagatttttgtgtgggtgtcaaagggtgtattaccacctaagggtgtctatgtatcattactc 47452420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 51898689 - 51898783
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||| | ||||||||| |||||||||    
T  51898689 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaagatgtctatgtatcattactc 51898783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 50630552 - 50630458
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||  |||| | |||||||| |||||||||| ||||||| |||||||||    
T  50630552 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtaacaaaggatgtattgccacctaagggtatctatgtatcattactc 50630458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 32813341 - 32813247
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||||| |||||||||||||||||||| |||| ||| |||||||||| |||||||| ||||||||| |||| ||||    
T  32813341 tgtgcttgtgcggggtccatgtgaccacgtgtcagatttttgtgtgggtgttaaagggtgtattgccacctaaggatgtctatgtatcataactc 32813247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 43226 - 43132
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||| |||||||||||||||||||||||||||||||| |||||||| | |||||||   ||||||  ||||||||| |||||||||    
T  43226 tgtgcttgtgcggagtccacgtgactacgtgtcagatttttgtgtgggtgtcaaaggatgtattgtctcctaagactgtctatgtatcattactc 43132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 41758899 - 41758805
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||  ||||||| |||||||||| |  ||| ||||||||||| |||||||||    
T  41758899 tgtgtttgtgcggggtccatgtgactacgtgtcagatttttgtgtggttgtcaaagggtgtattgccatttaatggtgtctatgtatcattactc 41758805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 34 - 126
Target Start/End: Original strand, 11152385 - 11152476
Alignment:
Q  34 gtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    |||||||||||||||| || |||||||||||||||||||||||||  |||| || |||||||||| |||||| ||||||||||| ||||||||    
T  11152385 gtgcttgtgcggggtctacatgactacgtgtcagatttttgtgtggatgtcgaagggtgtattgccacctaa-ggtgtctatgtttcattact 11152476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 37649292 - 37649198
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||  | |||||||| |||||||||||||||||||| ||||||||  ||||||||| |||||| | ||||||||| |||||||||    
T  37649292 tgtgcttgtgcggaattcacgtgaccacgtgtcagatttttgtgtgggtgtcaaagagtgtattgccacctaaagatgtctatgtatcattactc 37649198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 33 - 97
Target Start/End: Complemental strand, 13414855 - 13414791
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattg 97  Q
    |||||||||| ||||||||||||||||||||| ||||||||||||| |||||||| |||||||||    
T  13414855 tgtgcttgtgtggggtccacgtgactacgtgttagatttttgtgtgggtgtcaaagggtgtattg 13414791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 124
Target Start/End: Complemental strand, 26274522 - 26274435
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatta 124  Q
    ||||||| || |||||||||||| ||||||||||||| ||||  ||||||||| |||||||| || ||||||||||||||| ||||||    
T  26274522 cttgtgcaggatccacgtgactatgtgtcagatttttctgtggatgtcaaatgatgtattgccacataagggtgtctatgtatcatta 26274435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 33 - 107
Target Start/End: Original strand, 45044566 - 45044640
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagg 107  Q
    |||| |||||||||||||| ||| |||| |||||||||||||| || ||||||||||||||||||| ||||||||    
T  45044566 tgtgtttgtgcggggtccatgtggctacatgtcagatttttgtatgggtgtcaaatggtgtattgccacctaagg 45044640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 5959010 - 5959100
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  |||| || ||||||||||||||||| |||||||  |||||||||| || ||||||||| ||||| |||| ||||    
T  5959010 cttgtgcggggtccatatgaccacatgtcagatttttgtgtgggtgtcaagaggtgtattgccacttaagggtgtttatgtatcataactc 5959100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 115
Target Start/End: Original strand, 49811533 - 49811615
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctat 115  Q
    ||||||||||||| ||| |  || ||||||||||||||||||||||  |||||||||||||||||  |||||||| |||||||    
T  49811533 tgtgcttgtgcggagtctatatggctacgtgtcagatttttgtgtggatgtcaaatggtgtattgtcacctaaggatgtctat 49811615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 50591010 - 50591100
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  50591010 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 50591100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 41608503 - 41608593
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||| |||||||||  || | || |||||||||||||||||||||||||  |||||||||| |||||||| ||| ||||| |||| ||||    
T  41608503 cttgtacggggtccatatggccacatgtcagatttttgtgtgagtgtcaaggggtgtattgccacctaaggatgtttatgtatcataactc 41608593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 23597097 - 23597191
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||||  |||| ||||| | ||||||||||||||| |||| || |||||  ||||||||| |||||| | ||||||||| |||||||||    
T  23597097 tgtgtttgtgcaaggtcaacgtggccacgtgtcagatttttatgtgggtatcaaagagtgtattgccacctaatgatgtctatgtatcattactc 23597191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 115
Target Start/End: Complemental strand, 26440828 - 26440746
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctat 115  Q
    ||||||| |||||| |||| ||| | |||||||||||||||||||| |||| ||| |||||||||  | |||||| |||||||    
T  26440828 tgtgcttatgcgggatccatgtggccacgtgtcagatttttgtgtgggtgttaaagggtgtattgtcatctaaggatgtctat 26440746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 33 - 122
Target Start/End: Complemental strand, 44454073 - 44453984
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcat 122  Q
    |||||||||| ||| ||||||| || || ||||||||||||||||| || ||||  | |||||||| || ||| ||||||||||| ||||    
T  44454073 tgtgcttgtgtgggatccacgtaaccacatgtcagatttttgtgtgggtatcaagagatgtattgccacttaaaggtgtctatgtatcat 44453984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 33 - 78
Target Start/End: Complemental strand, 48489394 - 48489349
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtg 78  Q
    |||||||||||||| |||||||||| || |||||||||||||||||    
T  48489394 tgtgcttgtgcgggatccacgtgaccacatgtcagatttttgtgtg 48489349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 78
Target Start/End: Original strand, 44334176 - 44334221
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtg 78  Q
    |||| |||||| ||||||| ||||||||||||||| ||||||||||    
T  44334176 tgtgtttgtgctgggtccatgtgactacgtgtcaggtttttgtgtg 44334221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 32)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 33 - 124
Target Start/End: Complemental strand, 28863549 - 28863458
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatta 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| ||||||    
T  28863549 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcatta 28863458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 9058574 - 9058480
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  9058574 tgtgcttgtgcggggtccacatgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 9058480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 10249388 - 10249482
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||  |||||||||||||||||| |||||||||    
T  10249388 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgtcacctaagggtgtctatgtatcattactc 10249482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 32505654 - 32505748
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||  |||||||||||||||||| |||||||||    
T  32505654 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgtcacctaagggtgtctatgtatcattactc 32505748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 33436106 - 33436200
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  33436106 tgtgcttgtgcggggtccacgtgactacgtgttagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 33436200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 7465741 - 7465835
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||| | |||||||||||||||| |||||||||    
T  7465741 tgtgcttgtgtggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccatctaagggtgtctatgtatcattactc 7465835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 13438437 - 13438343
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||  |||||||||||||||||| |||||||||    
T  13438437 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaaggatgtattgtcacctaagggtgtctatgtatcattactc 13438343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 17473114 - 17473020
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||| | |||||||||||||||| |||||||||    
T  17473114 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccatctaagggtgtctatgtatcattactc 17473020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 40701572 - 40701478
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  40701572 tgtgattgtgcggggtccacgtaactacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgccacctaagggtgtctatgtatcattactc 40701478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 5574494 - 5574588
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| |||||||||||||||||||||||||| |||| |||||||| |||||||||| ||||||| |||||||||| |||||||||    
T  5574494 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttatgtgggtgtcaaagggtgtattgccacctaagagtgtctatgtatcattactc 5574588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 28381661 - 28381755
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||| ||||| || |||||||||| |||||||||||||||||| |||||||||    
T  28381661 tgtgcttgtgcggagtccatgtgactacgtgtcagatttttgtgtgggtgtcgaaaggtgtattgccacctaagggtgtctatgtatcattactc 28381755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 30915557 - 30915463
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||| ||||||||||||||||||||||||||||||| |||| | |||||| |||||||||| |||||||||||||||||| |||||||||    
T  30915557 tgtgcttgtacggggtccacgtgactacgtgtcagatttttatgtgggggtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 30915463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 33 - 124
Target Start/End: Original strand, 19930826 - 19930917
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatta 124  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||  ||||||| |||||||||| |||||||||||||||||| ||||||    
T  19930826 tgtgtttgtgcggggtccacatgactacgtgtcagatttttgtgtggatgtcaaagggtgtattgccacctaagggtgtctatgtatcatta 19930917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 27864798 - 27864704
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||||||||||||| |||||||||||||||||||||  ||||||| |||||||||| || ||||||||||||||| |||||||||    
T  27864798 tgtgcttttgcggggtccacgtgattacgtgtcagatttttgtgtggatgtcaaagggtgtattgccacataagggtgtctatgtatcattactc 27864704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 4060779 - 4060685
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||| ||||||| |||||||||||||||||||||||  ||||||| |||||||||  |||||||||||||||||| |||||||||    
T  4060779 tgtgcttatgcgggatccacgtaactacgtgtcagatttttgtgtggatgtcaaaaggtgtattgtcacctaagggtgtctatgtatcattactc 4060685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 20700909 - 20700815
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||||||||||||||||||||||||||||||||||  | |||||| |||||||||| || ||||| ||||||||| |||||||||    
T  20700909 tgtgcttatgcggggtccacgtgactacgtgtcagatttttgtgtaggagtcaaagggtgtattgccacataaggatgtctatgtatcattactc 20700815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 40613908 - 40614002
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||| | |||||||||||||||||||| |||||||| |||||||||| |||||||| ||||||||| |||| ||||    
T  40613908 tgtgcttgtgcggggtccatgtggccacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaggatgtctatgtatcataactc 40614002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 44 - 127
Target Start/End: Original strand, 38882831 - 38882913
Alignment:
Q  44 ggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||  ||||||| ||| |||||| |||||||||||||||||| |||||||||    
T  38882831 ggggtccacgtgactacgtgtcagatttttgtgtggatgtcaaagggt-tattgccacctaagggtgtctatgtatcattactc 38882913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 42257287 - 42257193
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||| | ||||||||||||||| |||| |||||||||| |||||||| |||||| | ||||||||| |||| ||||    
T  42257287 tgtgcttgtgcggggtccatgtggccacgtgtcagatttttatgtgggtgtcaaatgatgtattgccacctaaagatgtctatgtatcataactc 42257193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 2533217 - 2533124
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||| | ||| |||||||||||||||||||||| |||||||| | |||||||| || ||||| ||||||||| |||| ||||    
T  2533217 tgtgcttgtgcggggtctatgtggctacgtgtcagatttttgtgtg-gtgtcaaaggatgtattgccacttaaggatgtctatgtatcataactc 2533124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 26891510 - 26891604
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||| || |||||||||||| || ||||||||||||||||| ||||| |  |||||||||| ||||||||||| |||||| |||| ||||    
T  26891510 tgtgcttgttcgaggtccacgtgaccacatgtcagatttttgtgtgggtgtctaggggtgtattgccacctaagggtggctatgtatcataactc 26891604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 38273148 - 38273242
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||| |||||||||||| ||| |||||||||||||||||||||| |||| ||| |||||||||| | |||||  ||||||||| |||| ||||    
T  38273148 tgtgctagtgcggggtccatgtggctacgtgtcagatttttgtgtgggtgttaaagggtgtattgccatctaagaatgtctatgtatcataactc 38273242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 59 - 127
Target Start/End: Complemental strand, 33436279 - 33436211
Alignment:
Q  59 acgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||| |||| |||||||| |||||||||| | |||||| ||||||||| |||||||||    
T  33436279 acgtgtcagatttttatgtgggtgtcaaaaggtgtattgccatctaaggatgtctatgtatcattactc 33436211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 17820010 - 17820104
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||| ||||||||||| || || ||||||||||||||||| |||||||  |||||||||| |||||  | ||||||||| |||| ||||    
T  17820010 tgtgtttgtgtggggtccacgtaaccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctatagttgtctatgtatcataactc 17820104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 44 - 126
Target Start/End: Complemental strand, 41575220 - 41575138
Alignment:
Q  44 ggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    ||||||||| |||| || ||||| |||||||||||| ||||||| |||||||| | | |||||| ||||||||| ||||||||    
T  41575220 ggggtccacatgaccacatgtcaaatttttgtgtgaatgtcaaagggtgtattaccatctaaggatgtctatgtatcattact 41575138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 43490211 - 43490121
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||  |||||||||||| ||||| |||| ||||    
T  43490211 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgtcacctaagggtgtttatgtatcataactc 43490121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 114
Target Start/End: Complemental strand, 3440073 - 3439992
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtcta 114  Q
    |||||||||||||||||||||| |  || ||| ||||||||||||| ||||| |   ||||||||| |||||||||||||||    
T  3440073 tgtgcttgtgcggggtccacgtaatcacatgttagatttttgtgtgggtgtccaggagtgtattgccacctaagggtgtcta 3439992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 2997497 - 2997569
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggt 109  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| ||||||||||    
T  2997497 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggt 2997569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 3738037 - 3737986
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtc 84  Q
    |||||||||||||||||||| |||| || ||||||||||||||||| |||||    
T  3738037 tgtgcttgtgcggggtccacatgaccacatgtcagatttttgtgtgggtgtc 3737986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 38732444 - 38732354
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  |||| || ||||||||||||||||| |||||||  | |||||||  || ||||||||| ||||| |||| ||||    
T  38732444 cttgtgcggggtccatatgaccacatgtcagatttttgtgtgggtgtcaagggatgtattgtcacataagggtgtttatgtatcataactc 38732354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 127
Target Start/End: Complemental strand, 36168928 - 36168836
Alignment:
Q  35 tgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||| ||| | |||||||| ||||||||||| | || ||| | |||||||  | |||||| ||||||||| |||| ||||    
T  36168928 tgcttgtgcggggtccatgtggccacgtgtcaaatttttgtgtgggagttaaaggatgtattgtcatctaaggatgtctatgtatcataactc 36168836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 45097745 - 45097835
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || |||||||||||||| || |||||||  | |||||||| |||||||| ||| ||||| |||| ||||    
T  45097745 cttgtgcggggtccatatggccacatgtcagatttttgtatgggtgtcaagggatgtattgccacctaaggatgtttatgtatcataactc 45097835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 32)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 7389483 - 7389389
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||  ||||||||| |||||||||||||||||| |||||||||    
T  7389483 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagagtgtattgccacctaagggtgtctatgtatcattactc 7389389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 8080389 - 8080483
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||||||||||||||||||| |||  |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  8080389 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttatgtaggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 8080483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 19329936 - 19329842
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||| |||||||| ||||||||| |||||||||    
T  19329936 tgtgcttgtgcggggtccacgtgattacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgccacctaaggatgtctatgtatcattactc 19329842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 36361919 - 36362013
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||| | |||||||| |||||||||||||||||| |||||||||    
T  36361919 tgtgcttgtgtggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaaggatgtattgccacctaagggtgtctatgtatcattactc 36362013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 38267134 - 38267040
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||  || ||||||||||||||| |||||||||    
T  38267134 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgtcacataagggtgtctatgtatcattactc 38267040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 33 - 124
Target Start/End: Complemental strand, 3784089 - 3783998
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatta 124  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||||| | |||||||| |||||||||||||||||| ||||||    
T  3784089 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaaagatgtattgccacctaagggtgtctatgtatcatta 3783998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 3434656 - 3434562
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| |||||||||||||||||||| |||||||||| |||||||| |||||||||| |||||||| ||||||||| |||||||||    
T  3434656 tgtgcttgtgcgggatccacgtgactacgtgtcagttttttgtgtgggtgtcaaagggtgtattgccacctaaggatgtctatgtatcattactc 3434562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 4999520 - 4999614
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||| | |||||||||||||||| |||||||||    
T  4999520 tgtgtttgtgcggggtccacgtgactacgtatcagatttttgtgtgggtgtcaaaaggtgtattgccatctaagggtgtctatgtatcattactc 4999614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 35137627 - 35137533
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||| |||||||||||||||| | |||||||||    
T  35137627 tgtgtttgtgcggggtccacgtgactacgtgttagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatttatcattactc 35137533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 36362120 - 36362026
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||| | |||||| | |||||||||||||||||| |||||||||    
T  36362120 tgtgcttgtgtggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaaggatgtattaccacctaagggtgtctatgtatcattactc 36362026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 38837311 - 38837217
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||  ||||  || |||||||||| |||||||||||||||||| |||||||||    
T  38837311 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtaggtgtacaagggtgtattgccacctaagggtgtctatgtatcattactc 38837217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 19436193 - 19436287
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||  |||||||| ||||||||| |||||||||    
T  19436193 tgtgcttatgcgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaaaggtgtattgtcacctaaggatgtctatgtatcattactc 19436287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 40957801 - 40957707
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||| || |||||  ||||||||| ||||||| |||||||||| |||||||||    
T  40957801 tgtgcttgtacgggatccacgtgactacgtgtcagatttttgtgtgggtatcaaagagtgtattgccacctaagagtgtctatgtatcattactc 40957707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 21234495 - 21234401
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||| || ||| |||||||||| |||||||||||||||||||| |||||||||  |||||||| ||||||||| |||| ||||    
T  21234495 tgtgcttgtgcggggtacatgtggctacgtgtcaaatttttgtgtgagtgtcaaagggtgtattgtcacctaaggatgtctatgtatcataactc 21234401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 33 - 124
Target Start/End: Complemental strand, 3694461 - 3694370
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatta 124  Q
    |||||||||||||| ||||| ||||||||||||||||||||||||| |||| ||| |||||||||  |||||||||||| ||| | ||||||    
T  3694461 tgtgcttgtgcgggatccacatgactacgtgtcagatttttgtgtgggtgttaaaaggtgtattgtcacctaagggtgtgtatatatcatta 3694370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 46374808 - 46374902
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||| | |||||||||||||||||||| |||| ||| ||||| |||| |||||||| ||||||||| |||| ||||    
T  46374808 tgtgcttgtgcggggtccatgtggccacgtgtcagatttttgtgtgggtgttaaagggtgtgttgccacctaaggatgtctatgtatcataactc 46374902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 126
Target Start/End: Original strand, 32951499 - 32951592
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    |||||||||||||||||||||||||||||||| |||||||||||||  ||| ||| | |||||||  | ||||| |||||||||| ||||||||    
T  32951499 tgtgcttgtgcggggtccacgtgactacgtgttagatttttgtgtggatgttaaaggatgtattgtcatctaagagtgtctatgtatcattact 32951592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 8238303 - 8238212
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctaccta-agggtgtctatgtctcattactc 127  Q
    |||||||||||||||  ||||||| ||||||||||||||||| |||||||| |||||||||| ||||| ||||||| ||||| |||| ||||    
T  8238303 cttgtgcggggtccatatgactacatgtcagatttttgtgtgggtgtcaaagggtgtattgccacctacagggtgtttatgtatcataactc 8238212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 33 - 122
Target Start/End: Complemental strand, 35522970 - 35522881
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcat 122  Q
    |||||||||||||| ||||  || | |||||||||||||||||||| |||| |||||||||||||| || ||||| ||||||||| ||||    
T  35522970 tgtgcttgtgcgggatccatatggccacgtgtcagatttttgtgtgggtgttaaatggtgtattgccacttaaggatgtctatgtatcat 35522881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 36208267 - 36208173
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||| ||||||||||||| || |||||| |||||||||| |||||||    |||||| | |||||||||||||||||| |||| ||||    
T  36208267 tgtgcttgtgcagggtccacgtgaccacatgtcagctttttgtgtgggtgtcaatgaatgtattaccacctaagggtgtctatgtatcataactc 36208173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 38044287 - 38044197
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || |||| |||||||||||||||||  ||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  38044287 cttgtgcggggtccatatggctacatgtcagatttttgtgtggatgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 38044197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 7727996 - 7727906
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  |||| || |||||||||||| ||||| ||||||  |||||||| | |||||||||||| ||||| |||| ||||    
T  7727996 cttgtgcggggtccatatgaccacatgtcagatttttatgtgaatgtcaagaggtgtattaccacctaagggtgtttatgtatcataactc 7727906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 61 - 127
Target Start/End: Original strand, 10343597 - 10343663
Alignment:
Q  61 gtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||| |||||||   ||||||| | |||||||||||||||||| |||||||||    
T  10343597 gtgtcagatttttgtgtgggtgtcaagatgtgtatttccacctaagggtgtctatgtatcattactc 10343663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 22343451 - 22343361
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  ||   || ||||||||||||||||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  22343451 cttgtgcggggtccatatggtcacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 22343361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 39255934 - 39256023
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||| || ||||||||| | ||||||||||||||||| || || |||| ||||||||||| |||||||| ||||||||| |||| ||||    
T  39255934 cttgtgtggagtccacgtgcc-acgtgtcagatttttgtatgggtatcaagtggtgtattgccacctaaggttgtctatgtatcataactc 39256023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 41915831 - 41915741
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||  |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  41915831 cttgtgcggggtccatatggccacatgtcagatttttgtgtaggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 41915741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 35 - 127
Target Start/End: Original strand, 46033809 - 46033901
Alignment:
Q  35 tgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||| || || ||||| ||||||||||||||| |||| |||| ||| |||||||||| |||||||  | ||||||| |||| ||||    
T  46033809 tgcttgtgcggagttcatgtgaccacgtgtcagatttttatgtgggtgttaaagggtgtattgccacctaagaatatctatgtatcataactc 46033901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 11044268 - 11044188
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||          | |||||||| | |||||||| |||||||||||||||||| |||||||||    
T  11044268 cttgtgcggggtccacgtgactacgtgtcag----------gggtgtcaaaggatgtattgccacctaagggtgtctatgtatcattactc 11044188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 38 - 127
Target Start/End: Original strand, 40846124 - 40846213
Alignment:
Q  38 ttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||  | ||||| ||| |||||||||||||  ||||||  |||||||||| |||||||| ||| ||||| |||| ||||    
T  40846124 ttgtgcggggtccatataactacatgttagatttttgtgtggatgtcaaggggtgtattgccacctaaggatgtttatgtatcataactc 40846213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 127
Target Start/End: Complemental strand, 41423774 - 41423682
Alignment:
Q  35 tgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||| || ||||||| || |||||||||||||||| ||||||||  |||||||| | | |||| | ||||||||| |||| ||||    
T  41423774 tgcttgtacgggatctacgtgaccacatgtcagatttttgtgtaagtgtcaagaggtgtattaccatctaatgatgtctatgtatcataactc 41423682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 78
Target Start/End: Original strand, 16374830 - 16374875
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtg 78  Q
    |||||||||| | | |||||||||| ||||||||||||||||||||    
T  16374830 tgtgcttgtgtgagatccacgtgaccacgtgtcagatttttgtgtg 16374875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 127
Target Start/End: Original strand, 32564461 - 32564526
Alignment:
Q  62 tgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||| |||||||  |||||||||| |||||||  ||| ||||| |||| ||||    
T  32564461 tgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagaatgtttatgtatcataactc 32564526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 18)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 6209471 - 6209565
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||    
T  6209471 tgtgctagtgcggggtccacgtgactacgtgacagatttttgtgtgagtgtcaaatagtgtattgccacctaagggtgtctatgtatcattactc 6209565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 32869772 - 32869678
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| || ||||||    
T  32869772 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatctttactc 32869678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 33 - 124
Target Start/End: Original strand, 22880664 - 22880755
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatta 124  Q
    |||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||||| |||||||||||||||||| ||||||    
T  22880664 tgtgcttgtgcggggtccacgtgactacgtgtcagaattttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcatta 22880755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 17598648 - 17598554
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||| |||||||||||||||||||| |||||||| | |||||||| |||||||||||||||||| |||||||||    
T  17598648 tgtgcttgtgcggggtccacgtgacaacgtgtcagatttttgtgtgggtgtcaaaagatgtattgccacctaagggtgtctatgtatcattactc 17598554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 11427712 - 11427616
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctaccta--agggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||||| | |||||||| |||||  ||||||||||||| |||||||||    
T  11427712 tgtgcttgtgcgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaaggatgtattgccacctaagagggtgtctatgtatcattactc 11427616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 29857921 - 29857827
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||| ||||||| ||||||||||||||||||||||| |||| ||| |||||||||| | |||| ||||||||||| |||||||||    
T  29857921 tgtgcttatgcgggatccacgtaactacgtgtcagatttttgtgtgggtgttaaaaggtgtattgccatctaaaggtgtctatgtatcattactc 29857827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 41 - 115
Target Start/End: Original strand, 31109414 - 31109488
Alignment:
Q  41 tgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctat 115  Q
    ||||||||| ||||||||||||||||||||||||||||  ||||||| |||||||||| ||||||||||||||||    
T  31109414 tgcggggtctacgtgactacgtgtcagatttttgtgtggatgtcaaagggtgtattgccacctaagggtgtctat 31109488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 31976342 - 31976248
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||| || ||||| |||||||||||||||||||| |||| ||| ||| |||||| |||||||| ||||||||| |||| ||||    
T  31976342 tgtgcttgtgcggggttcatgtgaccacgtgtcagatttttgtgtgggtgttaaagggtatattgccacctaaggatgtctatgtatcataactc 31976248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 38 - 127
Target Start/End: Complemental strand, 15832666 - 15832577
Alignment:
Q  38 ttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||| || ||||||||||||||||||| ||||||||||| |||||||||| | |||||  |||||| ||||||||||| |||||||||    
T  15832666 ttgtgcaggatccacgtgactacgtgtcaaatttttgtgtgggtgtcaaatgatttattgtcacctaaaggtgtctatgtatcattactc 15832577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 31110767 - 31110859
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||| ||||||| |||  |||||||||||||||||||  ||||||||| |||||||||| |||||||| ||||||||| |||| ||||    
T  31110767 tgtgcttgtgcagggtccatgtggttacgtgtcagatttttgtg--agtgtcaaagggtgtattgccacctaaggatgtctatgtatcataactc 31110859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 23128133 - 23128196
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtatt 96  Q
    |||||||||| ||| ||||||||||||||||||||||||||||||| |||||||| | ||||||    
T  23128133 tgtgcttgtgtgggatccacgtgactacgtgtcagatttttgtgtgggtgtcaaaggatgtatt 23128196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 15508034 - 15508124
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  15508034 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 15508124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 15990052 - 15990142
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  15990052 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 15990142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 30341370 - 30341460
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  30341370 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 30341460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 33 - 123
Target Start/End: Original strand, 28536494 - 28536582
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcatt 123  Q
    |||||||||| ||||||||| ||||  ||||||||||||||||||| |||||||  | |||||||| |||||||| ||| ||||| |||||    
T  28536494 tgtgcttgtgtggggtccacatgac--cgtgtcagatttttgtgtgggtgtcaagggttgtattgccacctaaggatgtttatgtatcatt 28536582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 31953036 - 31953130
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||| ||||| | ||||||| |||  || |||||||||||| |||| |||||||  |||||||||| |||||||| ||||||| | |||||||||    
T  31953036 tgtgtttgtgtgaggtccacatgaacacatgtcagatttttatgtgggtgtcaaggggtgtattgccacctaaggatgtctatctatcattactc 31953130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 37 - 105
Target Start/End: Complemental strand, 4231638 - 4231570
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaa 105  Q
    |||||||||||||||  || | |||||||||||||||||||| ||| |||  |||||||||| ||||||    
T  4231638 cttgtgcggggtccatatggccacgtgtcagatttttgtgtgggtggcaaggggtgtattgccacctaa 4231570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 51 - 126
Target Start/End: Complemental strand, 946452 - 946377
Alignment:
Q  51 acgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattact 126  Q
    ||||||||| |||||||||||||| ||  |||||||| ||||||||   |||||||| ||||||||| || |||||    
T  946452 acgtgactaggtgtcagatttttgggtaggtgtcaaagggtgtattatcacctaaggatgtctatgtatcgttact 946377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 31)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 11511468 - 11511562
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  11511468 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttatgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 11511562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 41236441 - 41236347
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||| |||||||||| |||||||||||||||||| |||||||||    
T  41236441 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtggatgtcaaaaggtgtattgccacctaagggtgtctatgtatcattactc 41236347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 48183055 - 48183149
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| || ||||||||||||||| |||||||||    
T  48183055 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacgtaagggtgtctatgtatcattactc 48183149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 50052434 - 50052528
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||| ||||||||| |||||||||    
T  50052434 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaggatgtctatgtatcattactc 50052528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 54473539 - 54473633
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||  |||||||||||||||||| |||||||||    
T  54473539 tgtgcttgtgcggggtccacgtgactacgtgttagatttttgtgtgggtgtcaaatggtgtattgtcacctaagggtgtctatgtatcattactc 54473633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 480453 - 480547
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||  |||||||||||||||||| |||||||||    
T  480453 tgtgcttgtacggggtccacgtgactacgtgtcagatttttgtgtgggtgtcaaagggtgtattgtcacctaagggtgtctatgtatcattactc 480547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 6034138 - 6034044
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||||||||    
T  6034138 tgtgcttgtgcgggatccacgtgactacatgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaagggtgtctatgtatcattactc 6034044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 29239980 - 29239886
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| ||||||||||||||||||||| |||||||||||||  |||||||||||||||||| |||||||||||||||||| |||||||||    
T  29239980 tgtgcttgtgtggggtccacgtgactacgtgttagatttttgtgtggatgtcaaatggtgtattgccacctaagggtgtctatgtatcattactc 29239886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 42044373 - 42044467
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||  || | |||||||| |||||||||||||||||| |||||||||    
T  42044373 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgggtgtacaaggatgtattgccacctaagggtgtctatgtatcattactc 42044467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 3481748 - 3481654
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| |||||||||||||||| |||||||||||||||||| ||||||||  ||||||||| |||||| ||||||||||| |||||||||    
T  3481748 tgtgcttgtgtggggtccacgtgactatgtgtcagatttttgtgtgggtgtcaaagagtgtattgccacctaaaggtgtctatgtatcattactc 3481654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 29234251 - 29234345
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||   || ||||| |||||||||| | |||||||||||||||| |||||||||    
T  29234251 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgaaggtatcaaagggtgtattgccatctaagggtgtctatgtatcattactc 29234345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 23608329 - 23608235
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| || || ||||||||||||||||||||||||||||| ||||||||||||||||||  | |||||||||||||| | |||||||||    
T  23608329 tgtgcttgtgtggagttcacgtgactacgtgtcagatttttgtgtgggtgtcaaatggtgtattgtcatctaagggtgtctatatatcattactc 23608235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 24995113 - 24995207
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||||||||||||||||||||| |||||| |||| |||||||| |||||||||| | ||||||||||| || | |||||||||    
T  24995113 tgtgcttgtgcggggtccacgtgactacgtgtcaaatttttatgtgggtgtcaaagggtgtattgccatctaagggtgtccatatatcattactc 24995207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 34 - 127
Target Start/End: Original strand, 50526178 - 50526271
Alignment:
Q  34 gtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||  |||||||||| |||||||||||||||||||| |||||||| |||||||||| |||||| | ||||||||| |||||||||    
T  50526178 gtgcttgtgcggaatccacgtgaccacgtgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaagatgtctatgtatcattactc 50526271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 31910286 - 31910192
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| ||| ||| |||||||||||||||||| ||||||||  ||||||||  |||||||| ||||||||| |||| ||||    
T  31910286 tgtgcttgtgcggggtccatgtggctatgtgtcagatttttgtgtgggtgtcaaagagtgtattgtcacctaaggatgtctatgtatcataactc 31910192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 19670726 - 19670816
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || |||||||||||||||||||||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  19670726 cttgtgcggggtccatatggccacatgtcagatttttgtgtgagtgtcaaggggtgtattgccacctaagggtgtttatgtatcataactc 19670816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 122
Target Start/End: Original strand, 53352574 - 53352660
Alignment:
Q  35 tgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcat 122  Q
    |||||||||||||||||| | ||||||||||||||||||||||  |||| |||   |||||||| |||||||||||||||||| ||||    
T  53352574 tgcttgtgcggggtccacttaactacgtgtcagatttttgtgtaggtgttaaagaatgtattgc-acctaagggtgtctatgtatcat 53352660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 29977979 - 29977885
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||| ||||||||  ||||||||||||||||||||||||| |||| ||  |||||||||| ||||| || | | ||||| |||||||||    
T  29977979 tgtgcttgtgtggggtccatatgactacgtgtcagatttttgtgtgggtgttaaggggtgtattgccacctatggttctgtatgtatcattactc 29977885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 41823976 - 41823926
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgt 83  Q
    ||||||||||||||||||| |||||||||||||||||||||||||| ||||    
T  41823976 tgtgcttgtgcggggtccatgtgactacgtgtcagatttttgtgtgggtgt 41823926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 48647732 - 48647826
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||| ||||||||||| |||||| |||||||| |||| |||| ||  ||||||||| ||||||||| ||| ||||| |||| ||||    
T  48647732 tgtgcttgtgcggagtccacgtgaccacgtgttagatttttatgtgggtgttaagaggtgtattgttacctaaggatgtttatgtgtcataactc 48647826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 33 - 117
Target Start/End: Original strand, 28480274 - 28480358
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgt 117  Q
    |||| ||||| ||||||||| ||||||| |||||||||||||||||||||| ||   ||||||||  |||||||| |||||||||    
T  28480274 tgtgtttgtgtggggtccacatgactacatgtcagatttttgtgtgagtgttaagaagtgtattgtcacctaaggttgtctatgt 28480358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 33 - 117
Target Start/End: Original strand, 28481149 - 28481233
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgt 117  Q
    |||| ||||| ||||||||| ||||||| |||||||||||||||||||||| ||   ||||||||  |||||||| |||||||||    
T  28481149 tgtgtttgtgtggggtccacatgactacatgtcagatttttgtgtgagtgttaagaagtgtattgtcacctaaggttgtctatgt 28481233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 33 - 117
Target Start/End: Original strand, 28482024 - 28482108
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgt 117  Q
    |||| ||||| ||||||||| ||||||| |||||||||||||||||||||| ||   ||||||||  |||||||| |||||||||    
T  28482024 tgtgtttgtgtggggtccacatgactacatgtcagatttttgtgtgagtgttaagaagtgtattgtcacctaaggttgtctatgt 28482108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 60 - 127
Target Start/End: Complemental strand, 40574846 - 40574779
Alignment:
Q  60 cgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||||| |||||||| |||||||| | |||||||| ||||||||| |||| ||||    
T  40574846 cgtgtcagatttttgtgtgggtgtcaaagggtgtattaccacctaaggatgtctatgtatcataactc 40574779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 127
Target Start/End: Complemental strand, 55475256 - 55475191
Alignment:
Q  62 tgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||| |||||||| |||||||||| |||||||| ||| ||||| |||| ||||    
T  55475256 tgtcagatttttgtgtgggtgtcaaagggtgtattgccacctaaggatgtttatgtatcataactc 55475191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 17983753 - 17983825
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggt 109  Q
    |||||||||||||||  || | || ||||||||||||||||| |||||||  |||||||||| ||||||||||    
T  17983753 cttgtgcggggtccatatggccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacctaagggt 17983825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 47986298 - 47986208
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||||  || | || |||||||||||||||||  ||||||  | |||||||| |||||||||||| ||||| |||| ||||    
T  47986298 cttgtgcggggtccatatggccacatgtcagatttttgtgtggatgtcaagggatgtattgccacctaagggtgtttatgtatcataactc 47986208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 127
Target Start/End: Original strand, 50813902 - 50813992
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||| ||  |||| || ||||||||||||||||| |||||||  |||||||| | ||||||| |||| ||||| |||| ||||    
T  50813902 cttgtgcggggttcatatgaccacatgtcagatttttgtgtgggtgtcaaggggtgtattaccacctaagagtgtttatgtatcataactc 50813992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 62 - 127
Target Start/End: Original strand, 55079749 - 55079814
Alignment:
Q  62 tgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| || |||||||  |||||||||| |||||||||||| ||||| |||| ||||    
T  55079749 tgtcagatttttgtatgggtgtcaagaggtgtattgccacctaagggtgtttatgtatcataactc 55079814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 127
Target Start/End: Complemental strand, 32767048 - 32766958
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||||  || | || |||||||||||||| || |||||||  |||||||||| ||||||| |||| ||||| |||| ||||    
T  32767048 cttgtgcagggtccatatggccacatgtcagatttttgtatgggtgtcaaggggtgtattgccacctaagagtgtttatgtatcataactc 32766958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 127
Target Start/End: Original strand, 29547994 - 29548059
Alignment:
Q  62 tgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||||||||||| |||||||  | |||||||| |||||||| ||| ||||| |||| ||||    
T  29547994 tgtcagatttttgtgtgggtgtcaagggatgtattgccacctaaggatgtttatgtatcataactc 29548059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 127
Target Start/End: Complemental strand, 4123 - 4029
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||| |||||| ||||||| ||||||||||||||||||||||| |||| ||| |||||||||| | |||| ||||||||||| |||||||||    
T  4123 tgtgcttatgcgggatccacgtaactacgtgtcagatttttgtgtgggtgttaaaaggtgtattgccatctaaaggtgtctatgtatcattactc 4029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1268 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold1268
Description:

Target: scaffold1268; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 935 - 1029
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| | |||||||||||||||||| ||||||||||  ||| ||| |||||||||| |||||| | ||||||||| |||||||||    
T  935 tgtgcttgtgcgggattcacgtgactacgtgtcagttttttgtgtggatgttaaagggtgtattgccacctaaagatgtctatgtatcattactc 1029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1267 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold1267
Description:

Target: scaffold1267; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 935 - 1029
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    |||||||||||||| | |||||||||||||||||| ||||||||||  ||| ||| |||||||||| |||||| | ||||||||| |||||||||    
T  935 tgtgcttgtgcgggattcacgtgactacgtgtcagttttttgtgtggatgttaaagggtgtattgccacctaaagatgtctatgtatcattactc 1029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0321 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0321
Description:

Target: scaffold0321; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 10115 - 10209
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctatgtctcattactc 127  Q
    ||||||||| || |||||||||||||||||||||||||||| ||||  ||||||| | |||||||| |||||| ||||||||||| |||| ||||    
T  10115 tgtgcttgtacgcggtccacgtgactacgtgtcagatttttatgtggatgtcaaaggatgtattgccacctaaaggtgtctatgtatcataactc 10209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0110
Description:

Target: scaffold0110; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 115
Target Start/End: Original strand, 8873 - 8951
Alignment:
Q  37 cttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgtctat 115  Q
    |||||| |||||||||||||||| |||||| ||||||||||   |||||||| ||||||||  || ||||| |||||||    
T  8873 cttgtgtggggtccacgtgactatgtgtcaaatttttgtgtagatgtcaaatagtgtattgtcacttaaggatgtctat 8951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 33 - 78
Target Start/End: Complemental strand, 17148 - 17103
Alignment:
Q  33 tgtgcttgtgcggggtccacgtgactacgtgtcagatttttgtgtg 78  Q
    ||||||||||||||||||| ||||| || |||||||||||||||||    
T  17148 tgtgcttgtgcggggtccatgtgaccacatgtcagatttttgtgtg 17103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 38 - 111
Target Start/End: Complemental strand, 152587 - 152514
Alignment:
Q  38 ttgtgcggggtccacgtgactacgtgtcagatttttgtgtgagtgtcaaatggtgtattgctacctaagggtgt 111  Q
    ||||||||| ||||  |||| || ||||||||||||||||| |||||||  |||||||||| ||| ||||||||    
T  152587 ttgtgcgggatccatatgaccacatgtcagatttttgtgtgggtgtcaaggggtgtattgccacccaagggtgt 152514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University