View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18018_high_29 (Length: 223)

Name: NF18018_high_29
Description: NF18018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18018_high_29
NF18018_high_29
[»] chr8 (1 HSPs)
chr8 (43-223)||(23011158-23011338)


Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 23011338 - 23011158
Alignment:
Q  43 aactattcacatgattctattgtcagaattcctttggttcgatggcggatgttgcaatttcgatcgtggctactgtggttgaacgtttggtgggaccagc 142  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23011338 aactattcacatgattctattgtcagaatacctttggttcgatggcggatgttgcaatttcgatcgtggctactgtggttgaacgtttggtgggaccagc 23011239  T
Q  143 aatacgcgaaggaaaatgtgttctttgcgttaataagttcattggcgatcttgagaatgaaaagaaggagctggtattcga 223  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23011238 aatacgcgaaggaaaatgtgttctttgtgttaataagttcattggcgatcttgagaatgaaaagaaggagctggtattcga 23011158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University