View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18014_low_17 (Length: 221)

Name: NF18014_low_17
Description: NF18014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18014_low_17
NF18014_low_17
[»] chr3 (1 HSPs)
chr3 (12-204)||(31299431-31299622)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 12 - 204
Target Start/End: Original strand, 31299431 - 31299622
Alignment:
Q  12 agaaaatatcaaagaagtttatataatattttaaaataaattatgcaagatcgacataaatcacttaaatacatcatgaactatgaaaaacaaaagatta 111  Q
    |||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||    
T  31299431 agaatatatcaaagaagtttatata-tattttaaaataaattatgcaagatagacataaatcaattaaatacatcatgaactgtgaaaaacaaaagatta 31299529  T
Q  112 taaatagtattcatatgtaggcttggcaaaaagagcctaatcatcttgtcccatcccgctccgtcaataacccgtataaataagggcggagtg 204  Q
    ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31299530 taaatagtattcatatgtaggcttggcaaaaagggcctactcatcttgtcccatcccgctccgtcaataacccgtataaataagggcggagtg 31299622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University