View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18007_high_63 (Length: 262)

Name: NF18007_high_63
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18007_high_63
NF18007_high_63
[»] chr2 (1 HSPs)
chr2 (9-164)||(3038592-3038747)


Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 9 - 164
Target Start/End: Complemental strand, 3038747 - 3038592
Alignment:
Q  9 gatatgaaatagtgaaggattttgtacaggttatcaactattatttctacactttggggctacatgtggcagtgcccagtacaagtcctcctaggaagga 108  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3038747 gataagaaatagtgaaggattttgtacaggttatcaactattatttctacactttggggctacatgtggcagtgcccagtacaagtcctcctaggaagga 3038648  T
Q  109 aatttctctcaataagatgacgatagatgtataatgaggatgatgtaaatttagag 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3038647 aatttctctcaataagatgacgatagatgtataatgaggatgatgtaaatttagag 3038592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University