View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18006_low_23 (Length: 339)

Name: NF18006_low_23
Description: NF18006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18006_low_23
NF18006_low_23
[»] chr6 (2 HSPs)
chr6 (16-106)||(13890326-13890417)
chr6 (62-102)||(14000628-14000668)


Alignment Details
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 16 - 106
Target Start/End: Complemental strand, 13890417 - 13890326
Alignment:
Q  16 atgggttcatcattgtcattgtgtgtaagttg-ttgactgttgtgtttacttaattacagtgccaatagccgaatttataacatattgtaac 106  Q
    |||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13890417 atgggttcattattgtcattgtgtgtaagttgattgattgttgtgtttacttaattacagtgccaatagccgaatttataacatattgtaac 13890326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 62 - 102
Target Start/End: Original strand, 14000628 - 14000668
Alignment:
Q  62 tacttaattacagtgccaatagccgaatttataacatattg 102  Q
    |||||||| | | ||||||||||||||||||||||||||||    
T  14000628 tacttaatcagattgccaatagccgaatttataacatattg 14000668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University