View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18003_low_81 (Length: 205)

Name: NF18003_low_81
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18003_low_81
NF18003_low_81
[»] chr4 (1 HSPs)
chr4 (15-186)||(43534297-43534468)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 43534297 - 43534468
Alignment:
Q  15 gaaatgtatacacagcaaaatttagacctgcagaagacttactatttagcatttgactaaaattattgaaatttcatgattttacttatttatagaaagt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||    
T  43534297 gaaatgtatacacagcaaaatttagacctgcagaagacttactatttagcatttgactaaaattactgaaatttcatgattttacttatttatataaagt 43534396  T
Q  115 tagaaaaatgacatgcaatagagattttagtttaggagtgtaccatagtatccaaaaattgtattattagca 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43534397 tagaaaaatgacatgcaatagagattttagtttaggagtgtaccatagtatccaaaaattgtattattagca 43534468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University