View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18003_low_70 (Length: 248)

Name: NF18003_low_70
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18003_low_70
NF18003_low_70
[»] chr3 (2 HSPs)
chr3 (121-229)||(20385418-20385526)
chr3 (85-124)||(20385566-20385605)


Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 121 - 229
Target Start/End: Complemental strand, 20385526 - 20385418
Alignment:
Q  121 gaaaaatagaattgaattcggaattcaatagaaagtacggttcaaaactataatgcaaattacggttgctaggtttctgaaattctaaaagtggacggtg 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20385526 gaaaactagaattgaattcggaattcaatagaaagtacggttcaaaactataatgcaaattacggttgctaggtttctgaaattctaaaagtggacggtg 20385427  T
Q  221 gctagggtt 229  Q
    |||||||||    
T  20385426 gctagggtt 20385418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 85 - 124
Target Start/End: Complemental strand, 20385605 - 20385566
Alignment:
Q  85 tggaattggaatacggcaatcacagagttgacatgtgaaa 124  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  20385605 tggaattggaatacggcaatcacagagttgacatgtgaaa 20385566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University