View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17999_low_12 (Length: 251)

Name: NF17999_low_12
Description: NF17999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17999_low_12
NF17999_low_12
[»] chr1 (1 HSPs)
chr1 (144-247)||(47435040-47435146)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 144 - 247
Target Start/End: Original strand, 47435040 - 47435146
Alignment:
Q  144 tccaaggaaacatcaac---cactgcctatatcccatcttggtgtttcttacaatatctaacgaaatagttttcacgagcaggaacaagtggtgaaggaa 240  Q
    |||||||||||||||||   ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47435040 tccaaggaaacatcaacaaccactgcccatattccatcttggtgtttcttacaatatctaacgaaatagttttcacgagcaggaacaagtggtgaaggaa 47435139  T
Q  241 cctgaaa 247  Q
    |||||||    
T  47435140 cctgaaa 47435146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University