View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17998_low_25 (Length: 265)

Name: NF17998_low_25
Description: NF17998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17998_low_25
NF17998_low_25
[»] chr5 (1 HSPs)
chr5 (15-197)||(4270783-4270965)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 4270783 - 4270965
Alignment:
Q  15 taatacttgcacttagtggtagtggaatagaaaataccagaaactagagagaatatggatatgtcaatgtgatcaatagaaggttactggctactataca 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  4270783 taatacttgcacttagtggtagtggaatagaaaataccagaaactagagagaatatggatatatcaatgtgatcaatagaaggttactggctactataca 4270882  T
Q  115 tggatataaatatagatatagatgcggtactggcaccgagcacatgatnnnnnnnnntcactttattataacatctcacttag 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||    
T  4270883 tggatataaatatagatatagatgcggtactggcaccgagcacatgataaaaaaaaatcactttattataacatctcacttag 4270965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University