View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17990_low_48 (Length: 229)

Name: NF17990_low_48
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17990_low_48
NF17990_low_48
[»] chr4 (1 HSPs)
chr4 (18-211)||(5504617-5504810)
[»] chr2 (1 HSPs)
chr2 (69-152)||(11812269-11812353)


Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 5504617 - 5504810
Alignment:
Q  18 agggcgggggactggaaaactagcatgatagggtggcggaaaacggagatgctatcttaatctgtaccatactccctggattgaatagaactctgcctcg 117  Q
    |||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||    
T  5504617 agggtgggggactggaaaactagcatgacagggtggcggaaaatggagatgctatcttaatctgtatcatactcgctggattgaatagaactctggctcg 5504716  T
Q  118 agtttatat-aagttcattatccaaatatgatgaaataaattcaagaaccgatgctattacataacttaataatttcataacacgtagctgggaa 211  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5504717 agtttatatcaagttcattatccaaatatgatgaaataaattc-agaaccgatgctattacataacttaataatttcataacacgtagctgggaa 5504810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 152
Target Start/End: Original strand, 11812269 - 11812353
Alignment:
Q  69 ctatcttaatctgtaccatactccctggattgaatagaactctgcctcgagtttatat-aagttcattatccaaatatgatgaaa 152  Q
    |||||||||  |||| ||||||| |||| ||||||||| |||  |||||||||||||| ||||| || ||||||||||| |||||    
T  11812269 ctatcttaacttgtatcatactctctgggttgaatagacctcgccctcgagtttatatcaagtttatcatccaaatatggtgaaa 11812353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University