View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17990_low_23 (Length: 370)

Name: NF17990_low_23
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17990_low_23
NF17990_low_23
[»] chr1 (3 HSPs)
chr1 (281-355)||(47262996-47263070)
chr1 (145-208)||(47262865-47262928)
chr1 (18-74)||(47262738-47262794)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 4e-32; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 281 - 355
Target Start/End: Original strand, 47262996 - 47263070
Alignment:
Q  281 aagggtgatgaaggacggcatttattttagtgggatgggcaaagactagttcactttgacctttgcttgtttgat 355  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  47262996 aagggtgatgaaggacggcatttattttagtgggatgggcaaagactagttcactttgacttttgcttgtttgat 47263070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 145 - 208
Target Start/End: Original strand, 47262865 - 47262928
Alignment:
Q  145 taattaatgatgacgcgggaaactaactggtcagaacaaagacaggttcaaaggacagaacaga 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47262865 taattaatgatgacgcgggaaactaactggtcagaacaaagacaggttcaaaggacagaacaga 47262928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 47262738 - 47262794
Alignment:
Q  18 atggacatggttgaaaattttggagaataaagagtaatagaaagttaagtttgttat 74  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  47262738 atggacatggttgaaaattttggagaataaagagtaatagtaagttaagtttgttat 47262794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University