View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17990_high_37 (Length: 201)

Name: NF17990_high_37
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17990_high_37
NF17990_high_37
[»] chr4 (1 HSPs)
chr4 (22-153)||(16009706-16009837)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 22 - 153
Target Start/End: Original strand, 16009706 - 16009837
Alignment:
Q  22 gaggagcacagacactataaacaaacctggccaagttgtttcataaaatcgagtatttcaggacgagcaccaataccagttgaccaaactaccatcccat 121  Q
    ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16009706 gaggaacacggacactataaacaaacctggccaagttgtttcataaaatcgagtatttcaggacgagcaccaataccagttgaccaaactaccatcccat 16009805  T
Q  122 gaggcatagtaacaacttgaccactttctctt 153  Q
    |||||||||||||||| |||||||||||||||    
T  16009806 gaggcatagtaacaacctgaccactttctctt 16009837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University