View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17990_high_35 (Length: 220)

Name: NF17990_high_35
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17990_high_35
NF17990_high_35
[»] chr3 (2 HSPs)
chr3 (127-202)||(30646397-30646472)
chr3 (16-61)||(30646538-30646583)


Alignment Details
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 127 - 202
Target Start/End: Complemental strand, 30646472 - 30646397
Alignment:
Q  127 gaatcaacggtctgttatgggtagagagttgaggtctgcgaggaccaattcgtcgcattcttcaaatatggatccc 202  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  30646472 gaatcaacggtctgttatgggtagagagttgaggtctgtgaggaccaattcgtcgcattcttcaaatatggatccc 30646397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 30646583 - 30646538
Alignment:
Q  16 taggaggatttcttggtcttctagagggagtagagaaagacaaaga 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  30646583 taggaggatttcttggtcttctagagggagtagagaaagacaaaga 30646538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University