View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17990_high_28 (Length: 245)

Name: NF17990_high_28
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17990_high_28
NF17990_high_28
[»] chr4 (1 HSPs)
chr4 (18-227)||(26475516-26475725)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 26475725 - 26475516
Alignment:
Q  18 gtagccaagttgtacttcaattgggccctttgtattttgtccctcatagtagagataaactttcccaccttcgatatgaatttagagatgctaatgaaaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  26475725 gtagccaagttgtacttcaattgggccctttgtattttgtccctcatagtagagataaactttcccaccttcgatatgaatttagagatgctcatgaaaa 26475626  T
Q  118 aatgcaaatatgcgtggttttatagaagttcaggggagaaaagttgctcataatatgaatttagttgataccatgaggataattttgtttcaattttacc 217  Q
    |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26475625 aatgtatatatgcgtggttttatagaagttcaggggagaaaagttgctcataatatgaatttagttgataccatgaggataattttgtttcaattttacc 26475526  T
Q  218 aaattcatag 227  Q
    |||| |||||    
T  26475525 aaatccatag 26475516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University