View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17986_low_11 (Length: 241)

Name: NF17986_low_11
Description: NF17986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17986_low_11
NF17986_low_11
[»] chr2 (1 HSPs)
chr2 (81-178)||(43368729-43368826)


Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 81 - 178
Target Start/End: Original strand, 43368729 - 43368826
Alignment:
Q  81 gtgtaaatttgaggtctcacacagtttatctacttccgaactttggtgtttgatgttgttatgaccgacgttaaccttcacattcttcttatgctggc 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  43368729 gtgtaaatttgaggtctcacacagtttatctacttccgaactttggtgtttgatgttgttatgaccgacgttaaccttcacattctttttatgctggc 43368826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University