View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17978_high_41 (Length: 237)

Name: NF17978_high_41
Description: NF17978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17978_high_41
NF17978_high_41
[»] chr5 (2 HSPs)
chr5 (147-224)||(5546465-5546542)
chr5 (43-87)||(5546604-5546645)


Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 147 - 224
Target Start/End: Complemental strand, 5546542 - 5546465
Alignment:
Q  147 agattagatatctgatgatattccaaattggtgcaagcaaactaatcgtcgcgtatgatacttgacccctcatttctg 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5546542 agattagatatctgatgatattccaaattggtgcaagcaaactaatcgtcgcgtatgatacttgacccctcatttctg 5546465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 5546645 - 5546604
Alignment:
Q  43 attaaacaagatatagagtgaccactagtagtagtacctatcatt 87  Q
    |||||||||||||||||||||||   |||||||||||||||||||    
T  5546645 attaaacaagatatagagtgacc---agtagtagtacctatcatt 5546604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University