View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17972_low_67 (Length: 214)

Name: NF17972_low_67
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17972_low_67
NF17972_low_67
[»] chr1 (1 HSPs)
chr1 (1-198)||(47072943-47073140)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 47073140 - 47072943
Alignment:
Q  1 atctaaaactcattacccaaataagcaaatactcaaatcatatgtgttgatttgtgttgaacttataaattacaatgtttaaaaatactcaaatcatgtg 100  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  47073140 atctaaaactcattacccaaataagcaaatgctcaaatcatatgtgttgattagtgttgaacttataaattacaatgtttaaaaatactcaaatcatgtg 47073041  T
Q  101 ggttgacatggattaaacttcaaaattaaaatgtttattcgaactagtaaaacccgtgaaattatacatactaccatagagatttgaaaggaactaca 198  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47073040 ggttgacatggattaaacttgaaaattaaaatgttcattcgaactagtaaaacccgtgaaattatacatactaccatagagatttgaaaggaactaca 47072943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University