View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17971_low_40 (Length: 253)

Name: NF17971_low_40
Description: NF17971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17971_low_40
NF17971_low_40
[»] chr7 (8 HSPs)
chr7 (1-237)||(25533923-25534157)
chr7 (3-125)||(25526031-25526153)
chr7 (1-88)||(25540605-25540693)
chr7 (1-85)||(25516256-25516341)
chr7 (144-197)||(31418966-31419019)
chr7 (151-197)||(21453181-21453227)
chr7 (151-197)||(12003331-12003377)
chr7 (161-197)||(6472699-6472735)
[»] chr8 (6 HSPs)
chr8 (150-198)||(1667822-1667870)
chr8 (150-198)||(16658527-16658575)
chr8 (146-198)||(33360100-33360152)
chr8 (146-195)||(42808382-42808429)
chr8 (151-183)||(32381211-32381243)
chr8 (151-183)||(32435166-32435198)
[»] chr5 (7 HSPs)
chr5 (151-203)||(42740888-42740940)
chr5 (151-198)||(21745033-21745080)
chr5 (151-197)||(32863333-32863379)
chr5 (151-199)||(3173848-3173895)
chr5 (149-197)||(26063041-26063089)
chr5 (151-197)||(18740036-18740081)
chr5 (153-197)||(43299937-43299980)
[»] chr3 (4 HSPs)
chr3 (150-198)||(2339178-2339226)
chr3 (154-196)||(9456119-9456161)
chr3 (151-197)||(52893141-52893187)
chr3 (145-193)||(40922552-40922600)
[»] scaffold0005 (1 HSPs)
scaffold0005 (145-197)||(39323-39375)
[»] chr4 (8 HSPs)
chr4 (145-197)||(14800352-14800404)
chr4 (149-200)||(33754312-33754363)
chr4 (146-196)||(21421920-21421970)
chr4 (151-197)||(46164751-46164797)
chr4 (151-199)||(44504331-44504379)
chr4 (151-197)||(8433371-8433416)
chr4 (149-182)||(20037990-20038023)
chr4 (151-197)||(54785574-54785622)
[»] chr2 (1 HSPs)
chr2 (155-199)||(38978988-38979032)
[»] chr6 (3 HSPs)
chr6 (151-197)||(16497560-16497606)
chr6 (145-198)||(7170715-7170768)
chr6 (151-197)||(14125098-14125143)
[»] chr1 (3 HSPs)
chr1 (151-195)||(26014217-26014261)
chr1 (149-197)||(18994625-18994673)
chr1 (151-197)||(26354696-26354741)
[»] scaffold1160 (1 HSPs)
scaffold1160 (151-194)||(2168-2211)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 25534157 - 25533923
Alignment:
Q  1 tggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtacctttatatacaaatatgttgttagaagcatttagacgcaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25534157 tggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtacctttatatacaaatatgttgttagaagcatttagacgcaac 25534058  T
Q  101 actgtatcaagtttggctattttgtgggataaacaggaagcatttaaataatggggtggtggtggctcccccttgccaccccccagttccgccactgcac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||  ||||||||||||||||||||    
T  25534057 actgtatcaagtttggctattttgtgggataaacaggaagcatttaaataatggggtggcggtggctcccccttgcca--ccccagttccgccactgcac 25533960  T
Q  201 cacgcatgacccattttcaagactccacccttcctcg 237  Q
    |||||||||||||||||||||||||||||||||||||    
T  25533959 cacgcatgacccattttcaagactccacccttcctcg 25533923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 3 - 125
Target Start/End: Complemental strand, 25526153 - 25526031
Alignment:
Q  3 gtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtacctttatatacaaatatgttgttagaagcatttagacgcaacac 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||    
T  25526153 gtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtaccttcatatacaaatatgtcgttagaagcatttagacgcaacac 25526054  T
Q  103 tgtatcaagtttggctattttgt 125  Q
    |||||||||||||||||||||||    
T  25526053 tgtatcaagtttggctattttgt 25526031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 25540693 - 25540605
Alignment:
Q  1 tggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtaccttt-atatacaaatatgttgttagaagca 88  Q
    |||||||||||||||||||||||| ||||||||||||||||||  |||  || |||||||||| |||||||| ||||||||||||||||    
T  25540693 tggtttactttcaaatgcatcgagtttcctaagaacacattcatttacctaacatgtacctttcatatacaactatgttgttagaagca 25540605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 25516256 - 25516341
Alignment:
Q  1 tggtttactttcaaatgcatcgagattcctaagaacacattcagctactgaatatgtacct-ttatatacaaatatgttgttagaa 85  Q
    |||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||| |||| | | |||||| ||||| |||||||    
T  25516256 tggtttactttcaaatgcatcgaggttcctaagaacacatccagctactgaacatgcacctgtcagatacaactatgtagttagaa 25516341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 144 - 197
Target Start/End: Complemental strand, 31419019 - 31418966
Alignment:
Q  144 ttaaataatggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    |||||||||||||||| |||||||||||||||||||||||| ||||||||||||    
T  31419019 ttaaataatggggtggcggtggctcccccttgccaccccccggttccgccactg 31418966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 21453181 - 21453227
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
T  21453181 atggggtggcggtggctcccccttgccaccccccagttccgccactg 21453227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 12003331 - 12003377
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||    
T  12003331 atggggtggcggtggctcctccttgccaccccccagttccgccactg 12003377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 161 - 197
Target Start/End: Original strand, 6472699 - 6472735
Alignment:
Q  161 ggtggctcccccttgccaccccccagttccgccactg 197  Q
    |||||||||||||||||||||||||||||||||||||    
T  6472699 ggtggctcccccttgccaccccccagttccgccactg 6472735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 150 - 198
Target Start/End: Complemental strand, 1667870 - 1667822
Alignment:
Q  150 aatggggtggtggtggctcccccttgccaccccccagttccgccactgc 198  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||    
T  1667870 aatggggtggcggtggctcccccttgccaccccccagttccgccactgc 1667822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 150 - 198
Target Start/End: Complemental strand, 16658575 - 16658527
Alignment:
Q  150 aatggggtggtggtggctcccccttgccaccccccagttccgccactgc 198  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||    
T  16658575 aatggggtggcggtgtctcccccttgccaccccccagttccgccactgc 16658527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 146 - 198
Target Start/End: Complemental strand, 33360152 - 33360100
Alignment:
Q  146 aaataatggggtggtggtggctcccccttgccaccccccagttccgccactgc 198  Q
    |||||||||||||| ||||||||||||||||||||||| | ||||||||||||    
T  33360152 aaataatggggtggcggtggctcccccttgccaccccctaattccgccactgc 33360100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 146 - 195
Target Start/End: Complemental strand, 42808429 - 42808382
Alignment:
Q  146 aaataatggggtggtggtggctcccccttgccaccccccagttccgccac 195  Q
    |||||||||||||| |||||||||||  ||||||||||||||||||||||    
T  42808429 aaataatggggtggcggtggctcccc--tgccaccccccagttccgccac 42808382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 183
Target Start/End: Complemental strand, 32381243 - 32381211
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccc 183  Q
    ||||||||| |||||||||||||||||||||||    
T  32381243 atggggtggcggtggctcccccttgccaccccc 32381211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 183
Target Start/End: Complemental strand, 32435198 - 32435166
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccc 183  Q
    ||||||||| |||||||||||||||||||||||    
T  32435198 atggggtggcggtggctcccccttgccaccccc 32435166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 203
Target Start/End: Original strand, 42740888 - 42740940
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactgcaccac 203  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||    
T  42740888 atggggtggcggtggctcccccttgccaccccccagttccgccactgctccac 42740940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 21745033 - 21745080
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactgc 198  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
T  21745033 atggggtggcggtggctcccccttgccaccccccagttccgccactgc 21745080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 32863379 - 32863333
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
T  32863379 atggggtggcggtggctcccccttgccaccccccagttccgccactg 32863333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 199
Target Start/End: Complemental strand, 3173895 - 3173848
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactgca 199  Q
    ||||||||| ||||||||||||||||||| |||||||||||||||||||    
T  3173895 atggggtggcggtggctcccccttgccac-ccccagttccgccactgca 3173848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 26063089 - 26063041
Alignment:
Q  149 taatggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||||| |||||||||||||||||||||||| | ||||||||||    
T  26063089 taatggggtggcggtggctcccccttgccaccccccggctccgccactg 26063041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 18740036 - 18740081
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| ||||||||||||||||||  |||||||||||||||||    
T  18740036 atggggtggcggtggctcccccttgcca-accccagttccgccactg 18740081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 43299980 - 43299937
Alignment:
Q  153 ggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||| ||||||||||||||||||  |||||||||||||||||    
T  43299980 ggggtggcggtggctcccccttgcca-accccagttccgccactg 43299937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 150 - 198
Target Start/End: Original strand, 2339178 - 2339226
Alignment:
Q  150 aatggggtggtggtggctcccccttgccaccccccagttccgccactgc 198  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||    
T  2339178 aatggggtggcggtggctcccccttgccaccccccagttccgccactgc 2339226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 9456161 - 9456119
Alignment:
Q  154 gggtggtggtggctcccccttgccaccccccagttccgccact 196  Q
    |||||| ||||||||||||||||||||||||||||||||||||    
T  9456161 gggtggcggtggctcccccttgccaccccccagttccgccact 9456119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 52893187 - 52893141
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| |||||||||||||||||| ||||||||||||||||||    
T  52893187 atggggtggcggtggctcccccttgccaacccccagttccgccactg 52893141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 193
Target Start/End: Complemental strand, 40922600 - 40922552
Alignment:
Q  145 taaataatggggtggtggtggctcccccttgccaccccccagttccgcc 193  Q
    |||| |||||||||| |||||||||||||||||||||||  ||||||||    
T  40922600 taaaaaatggggtggcggtggctcccccttgccaccccctggttccgcc 40922552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 39375 - 39323
Alignment:
Q  145 taaataatggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    |||||||||||||||  |||||||||||||||||||||| |||||||||||||    
T  39375 taaataatggggtggctgtggctcccccttgccaccccctagttccgccactg 39323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 14800352 - 14800404
Alignment:
Q  145 taaataatggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    |||||||||||||||  |||||||||||||||||||||| |||||||||||||    
T  14800352 taaataatggggtggctgtggctcccccttgccaccccctagttccgccactg 14800404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 33754312 - 33754363
Alignment:
Q  149 taatggggtggtggtggctcccccttgccaccccccagttccgccactgcac 200  Q
    ||||||||||| ||||||||||||||||||||||||||||| ||||| ||||    
T  33754312 taatggggtggcggtggctcccccttgccaccccccagttctgccaccgcac 33754363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 146 - 196
Target Start/End: Complemental strand, 21421970 - 21421920
Alignment:
Q  146 aaataatggggtggtggtggctcccccttgccaccccccagttccgccact 196  Q
    |||||||||||||| |||||||||||||||||||||||  | |||||||||    
T  21421970 aaataatggggtggcggtggctcccccttgccaccccctggctccgccact 21421920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 46164751 - 46164797
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    |||| |||| |||||||||||||||||||| ||||||||||||||||    
T  46164751 atggagtggcggtggctcccccttgccaccacccagttccgccactg 46164797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 199
Target Start/End: Complemental strand, 44504379 - 44504331
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactgca 199  Q
    ||||||||| |||||||||||||||||| |||| ||||||||| |||||    
T  44504379 atggggtggcggtggctcccccttgccaacccctagttccgcccctgca 44504331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 8433371 - 8433416
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| |||||||||||||||||| ||||| ||||||||||||    
T  8433371 atggggtggcggtggctcccccttgcca-cccccggttccgccactg 8433416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 182
Target Start/End: Complemental strand, 20038023 - 20037990
Alignment:
Q  149 taatggggtggtggtggctcccccttgccacccc 182  Q
    |||||||| |||||||||||||||||||||||||    
T  20038023 taatggggaggtggtggctcccccttgccacccc 20037990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 54785574 - 54785622
Alignment:
Q  151 atggggtggtggtggc--tcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| ||||||  |||||||| ||||||||||||||||||||||    
T  54785574 atggggtggcggtggcgctcccccttcccaccccccagttccgccactg 54785622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 199
Target Start/End: Original strand, 38978988 - 38979032
Alignment:
Q  155 ggtggtggtggctcccccttgccaccccccagttccgccactgca 199  Q
    ||||||||||||||||||||||||||||||||||||| |||||||    
T  38978988 ggtggtggtggctcccccttgccaccccccagttccgtcactgca 38979032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 16497560 - 16497606
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||    
T  16497560 atggggtggcggtggctcccccttgccaccccgcagttccgccactg 16497606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 145 - 198
Target Start/End: Complemental strand, 7170768 - 7170715
Alignment:
Q  145 taaataatggggtggtggtggctcccccttgccaccccccagttccgccactgc 198  Q
    ||||||||||||||| |||||||||||||||||||||||  ||||||| |||||    
T  7170768 taaataatggggtggcggtggctcccccttgccaccccctggttccgcaactgc 7170715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 14125098 - 14125143
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||| | |||||||||||||||||| ||||||||||||||||||    
T  14125098 atggggtagcggtggctcccccttgcca-cccccagttccgccactg 14125143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 195
Target Start/End: Complemental strand, 26014261 - 26014217
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccac 195  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||    
T  26014261 atggggtggcggtggctcccccttgccaccccccaattccgccac 26014217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 18994625 - 18994673
Alignment:
Q  149 taatggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||||| |||||||||||||||||||||||  | ||||||||||    
T  18994625 taatggggtggcggtggctcccccttgccaccccctggctccgccactg 18994673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 26354741 - 26354696
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgccactg 197  Q
    ||||||||| |||||||||||||||||| || |||||||||||||||    
T  26354741 atggggtggcggtggctcccccttgcca-cctccagttccgccactg 26354696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1160 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1160
Description:

Target: scaffold1160; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 194
Target Start/End: Complemental strand, 2211 - 2168
Alignment:
Q  151 atggggtggtggtggctcccccttgccaccccccagttccgcca 194  Q
    ||||||||| |||||||||||||| |||||||| ||||||||||    
T  2211 atggggtggcggtggctcccccttaccaccccctagttccgcca 2168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University