View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17969_low_12 (Length: 236)

Name: NF17969_low_12
Description: NF17969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17969_low_12
NF17969_low_12
[»] chr2 (2 HSPs)
chr2 (86-221)||(7259107-7259241)
chr2 (1-92)||(7258705-7258796)


Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 86 - 221
Target Start/End: Original strand, 7259107 - 7259241
Alignment:
Q  86 ctaagtatatcacaaccaaaatcttcaataaaatacctctagagctaactagtctttagcatttcatcaaatgatatttcattcaattatgaatcataac 185  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
T  7259107 ctaagtatatcacaaccaaaatcttcaataaaatac-tctagagctaactagtctttagcatttcaataaatgatatttcattcaattatgaatcataac 7259205  T
Q  186 ttttgtttcttgatacttgtcttcgaagtataaaat 221  Q
    |||||||||||||||||||||||| |||||||||||    
T  7259206 ttttgtttcttgatacttgtcttcaaagtataaaat 7259241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 7258705 - 7258796
Alignment:
Q  1 ctatcgtagaagaaaaaacattacatctactaataaagacaacaaaaagagctcaaataaaatttgaagccaaactagaaaaagactaagta 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  7258705 ctatcgtagaagaaaaaacattacatctactaataaagacaacaaaaagagctcaaataaaatttgaagccaaactagaaaaagaccaagta 7258796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University