View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17969_high_10 (Length: 211)

Name: NF17969_high_10
Description: NF17969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17969_high_10
NF17969_high_10
[»] chr4 (1 HSPs)
chr4 (14-196)||(1006495-1006676)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 1006495 - 1006676
Alignment:
Q  14 caaaggtggggtttaggagggtcacgaaagctgttagggtttaattattattctttagctagacttattaacgtggttgtcccgaattatgcaggaaatg 113  Q
    |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1006495 caaaggtggggtttag-agggtcgcgaaagctgttagggtttaattattattctttagctagacttattaacgtggttgtcccgaattatgcaggaaatg 1006593  T
Q  114 gagccatgcactttgagagttacttgcaaaggatggtaagaatggcagcaacggaccaagccgtcttagagtattataatact 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1006594 gagccatgcactttgagagttacttgcaaaggatggtaagaatggcagcaacggaccaagccgtcttagagtattataatact 1006676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University