View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17968_high_3 (Length: 224)

Name: NF17968_high_3
Description: NF17968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17968_high_3
NF17968_high_3
[»] chr5 (1 HSPs)
chr5 (15-212)||(36702976-36703173)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 15 - 212
Target Start/End: Complemental strand, 36703173 - 36702976
Alignment:
Q  15 ttatactccaagttttccttcaacactcatgttgaattaaggcagttgaggaaacacaatgcttattgatgaggaggtggaaatttgatctctactcttt 114  Q
    ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
T  36703173 ttataatccaagtcttccttcaacactcatgttgaattaaggcagttgaggaaacacaatggttattcatgaggaggtggaaatttgatctctactcttt 36703074  T
Q  115 cttgtgtttgattcgaagggttaatttgcatgtgttgcggttcatcatagttagcacaagctttctttcctcataaccctcacattgatgaaatttct 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||    
T  36703073 cttgtgtttgattcgaagggttaatttgcatgtgttgcggttcatcatagttagcacaagctttctttcctcacaaccctcacatcgatgaaatttct 36702976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University