View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17964_low_51 (Length: 216)

Name: NF17964_low_51
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17964_low_51
NF17964_low_51
[»] chr4 (1 HSPs)
chr4 (20-180)||(4531375-4531536)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 4531536 - 4531375
Alignment:
Q  20 aataataaattcaactttatcacaatatcaagttacaaaatcagaatgaggacttacccttttgaagattgaaaactttttcacaataaaagctacttat 119  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  4531536 aataataaattcaattttatcacaatatcaagttacaaaatcagaatgaggacttacccttttgaagattgaaaactttatcacaataaaagctacttat 4531437  T
Q  120 ttaatgactctagccaccaattggcacaga-aaaagctgtgaaagagaagaataaaagttgg 180  Q
    |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||    
T  4531436 ttaatgactctagccagcaattggcacagaaaaaagctgtgaaagagaagaataaaagttgg 4531375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University