View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17964_low_42 (Length: 241)

Name: NF17964_low_42
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17964_low_42
NF17964_low_42
[»] chr1 (2 HSPs)
chr1 (14-225)||(39777062-39777273)
chr1 (90-150)||(20607680-20607740)
[»] chr7 (1 HSPs)
chr7 (87-208)||(44207328-44207449)
[»] scaffold0012 (1 HSPs)
scaffold0012 (124-208)||(185187-185272)


Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 39777062 - 39777273
Alignment:
Q  14 tgaatgatgatgtaatggaagcaacagaagaatttgatgaactctgtgacttctcatgctccgtgttgctaatattaaccttaaggcagaaaacatgaac 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39777062 tgaatgatgatgtaatggaagcaacagaagaatttgatgaactctgtgacttctcatgctccgtgttgctaatattaaccttaaggcagaaaacatgaac 39777161  T
Q  114 ggtgcccttatcactagagactgctaaccactgagccgtagatgagaacgccaaactgtaaatctctgccgcatttgcaccccttcttacctaaatttga 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39777162 ggtgcccttatcactagagactgctaaccactgagccgtagatgagaacgccaaactgtaaatctctgccgcatttgcaccccttcttacctaaatttga 39777261  T
Q  214 tcccaagaaact 225  Q
    ||||||||||||    
T  39777262 tcccaagaaact 39777273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 150
Target Start/End: Complemental strand, 20607740 - 20607680
Alignment:
Q  90 aaccttaaggcagaaaacatgaacggtgcccttatcactagagactgctaaccactgagcc 150  Q
    |||||||||||  |||||||| || || ||||||||||| || ||||||||||||||||||    
T  20607740 aaccttaaggctaaaaacatggacagtacccttatcacttgaaactgctaaccactgagcc 20607680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 87 - 208
Target Start/End: Complemental strand, 44207449 - 44207328
Alignment:
Q  87 attaaccttaaggcagaaaacatgaacggtgcccttatcactagagactgctaaccactgagccgtagatgagaacgccaaactgtaaatctctgccgca 186  Q
    ||||||||||||||  || |||||||| |||||||| ||||| || ||||||||||||||||| || || || ||||||||||| || |||||||| |||    
T  44207449 attaaccttaaggctaaagacatgaacagtgcccttgtcacttgaaactgctaaccactgagctgtggaggaaaacgccaaactatatatctctgctgca 44207350  T
Q  187 tttgcaccccttcttacctaaa 208  Q
    |||||||||||||| |||||||    
T  44207349 tttgcaccccttctaacctaaa 44207328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0012 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0012
Description:

Target: scaffold0012; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 208
Target Start/End: Complemental strand, 185272 - 185187
Alignment:
Q  124 tcactagagactgctaaccactgagccgtagatgagaacgccaaactgtaaatctctgccg-catttgcaccccttcttacctaaa 208  Q
    ||||| || ||||||||||||| |||||| || || |||||||||||  | || ||||| | ||||||||||||||||||||||||    
T  185272 tcacttgaaactgctaaccactaagccgtggaagaaaacgccaaactacatatttctgctggcatttgcaccccttcttacctaaa 185187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University