View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17962_low_66 (Length: 213)

Name: NF17962_low_66
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17962_low_66
NF17962_low_66
[»] chr1 (1 HSPs)
chr1 (110-213)||(2786164-2786267)
[»] chr5 (1 HSPs)
chr5 (165-209)||(22518237-22518281)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 110 - 213
Target Start/End: Original strand, 2786164 - 2786267
Alignment:
Q  110 acatcatcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa 209  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2786164 acatcgtcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa 2786263  T
Q  210 caag 213  Q
    ||||    
T  2786264 caag 2786267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 22518281 - 22518237
Alignment:
Q  165 gactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa 209  Q
    ||||||||||| ||||||||||||| |||||||||||||| ||||    
T  22518281 gactcaaggcactgcgggcttccctaaaaccttctgatattaaaa 22518237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University