View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17962_low_65 (Length: 213)

Name: NF17962_low_65
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17962_low_65
NF17962_low_65
[»] chr1 (1 HSPs)
chr1 (119-213)||(2786243-2786337)


Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 119 - 213
Target Start/End: Complemental strand, 2786337 - 2786243
Alignment:
Q  119 aaatcttcccaaaatcaaagccatctacaatgctggagctgtcaatccacctgttgatgcgaaaccccctcttgttttgatatcagaaggtttca 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||    
T  2786337 aaatcttcccaaaatcaaagccatctacaatgctggagctgtcaatccaccggttgatgctaaaccccctcttgttttgatatcagaaggtttca 2786243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University