View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17962_low_51 (Length: 239)

Name: NF17962_low_51
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17962_low_51
NF17962_low_51
[»] chr7 (3 HSPs)
chr7 (1-150)||(27774770-27774920)
chr7 (186-239)||(27774681-27774734)
chr7 (8-48)||(27802186-27802226)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 27774920 - 27774770
Alignment:
Q  1 cacttcttctgctacaaaggggtgagactgcagctatgggaactcttgttcaatttcttggtgtgattcagtttgaacatacgccatgcacataattcaa 100  Q
    ||||| |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27774920 cactttttctgctacaaaggggtgagactgcagctatgggatttcttgttcaatttcttggtgtgattcagtttgaacatacgccatgcacataattcaa 27774821  T
Q  101 tatgatatgtgacct-aactctttgtgtagcttatctatcttatcacggta 150  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  27774820 tatgatatgtgacctaaactctttgtgtagcttatctatcttatcacggta 27774770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 27774734 - 27774681
Alignment:
Q  186 ccaagaccttgttcccctctgcctcccaaatgccggctttatatattgcctttg 239  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  27774734 ccaagaccttgttcccctctgcctcccaaatgccggctttatatattgtctttg 27774681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 27802186 - 27802226
Alignment:
Q  8 tctgctacaaaggggtgagactgcagctatgggaactcttg 48  Q
    |||||||||||| |||| |||||||||||||||| ||||||    
T  27802186 tctgctacaaagaggtgggactgcagctatgggagctcttg 27802226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University