View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17962_low_13 (Length: 440)

Name: NF17962_low_13
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17962_low_13
NF17962_low_13
[»] chr1 (3 HSPs)
chr1 (213-279)||(14193669-14193735)
chr1 (316-382)||(14193740-14193806)
chr1 (50-152)||(14193515-14193626)


Alignment Details
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 213 - 279
Target Start/End: Original strand, 14193669 - 14193735
Alignment:
Q  213 ttaaacagggatatttcaattctctttactttctgttggatgaaaagcttatgcaggtggtgaagat 279  Q
    ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||    
T  14193669 ttaaacagggatatttcaattctgtttactttctgttggatggaaagcttatgcaggtgttgaagat 14193735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 14193740 - 14193806
Alignment:
Q  316 tgaggttatttgaattttccaagttgttgattgactttgtggttttatttctctgcttgcaaattgt 382  Q
    ||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||    
T  14193740 tgaggttatttgaattttccaagttgttgattgaccttatggttttatttctctgtttgcaaattgt 14193806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 50 - 152
Target Start/End: Original strand, 14193515 - 14193626
Alignment:
Q  50 gacttatctggcataaaccccggctttgttatgagaccagtaggaactttatccg---------cgaaatgcaatctaatcctttgaaaatcataggagt 140  Q
    ||||||| |||||||||  |||| || ||||||||||||||||||||||||| ||         |||||||||||||| || || ||||||| |||||||    
T  14193515 gacttatgtggcataaatgccggattggttatgagaccagtaggaactttattcgagaaggtcgcgaaatgcaatctactcgttggaaaatcgtaggagt 14193614  T
Q  141 tttggctgctac 152  Q
    ||||||||||||    
T  14193615 tttggctgctac 14193626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University