View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17961_low_33 (Length: 235)

Name: NF17961_low_33
Description: NF17961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17961_low_33
NF17961_low_33
[»] chr1 (2 HSPs)
chr1 (101-235)||(3311123-3311257)
chr1 (53-122)||(3311280-3311348)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 101 - 235
Target Start/End: Complemental strand, 3311257 - 3311123
Alignment:
Q  101 attatgtaatatcgacgaccctaaaaggcacccattaaacatcctagaatgagggtggtggggtgtgttagttgatgattatactgatattttcggttgc 200  Q
    |||||||||||||||| ||||||||||  |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  3311257 attatgtaatatcgacaaccctaaaagttacccattaaacaacctagaatgatggtggtggggtgtgttagttgatgattatactgatattttcggttgc 3311158  T
Q  201 acaaatgggaaaagcaaaggagcatttaagagtag 235  Q
     ||| ||||||||||||||||||||||||||||||    
T  3311157 gcaagtgggaaaagcaaaggagcatttaagagtag 3311123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 53 - 122
Target Start/End: Complemental strand, 3311348 - 3311280
Alignment:
Q  53 tacaaatatcatttctccgtcattcaagtgattaacataaccctttcgattatgtaatatcgacgaccct 122  Q
    ||||||||| ||||||||||| || |||||||||||||||||||||| |||||||||||||||| |||||    
T  3311348 tacaaatat-atttctccgtcgtttaagtgattaacataaccctttcaattatgtaatatcgacaaccct 3311280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University