View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1795_high_3 (Length: 325)

Name: NF1795_high_3
Description: NF1795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1795_high_3
NF1795_high_3
[»] chr2 (3 HSPs)
chr2 (31-159)||(7682810-7682938)
chr2 (195-257)||(7682749-7682811)
chr2 (20-244)||(16196117-16196356)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 31 - 159
Target Start/End: Complemental strand, 7682938 - 7682810
Alignment:
Q  31 aaatgccccctttgttatgcattccctcaccttttctctttttctactaaaaaagaggctctggtgggggacctttgggccttgacagacggtgtggggg 130  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  7682938 aaatgccccctttgtgatgcattccctcaccttttctctttttctactaaaaaaaaggctctggtgggggacctttgggccttgacagacggtgtggggg 7682839  T
Q  131 gatggtcgtttgtttggaggagataacct 159  Q
    |||||||||||||||||||||||||||||    
T  7682838 gatggtcgtttgtttggaggagataacct 7682810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 195 - 257
Target Start/End: Complemental strand, 7682811 - 7682749
Alignment:
Q  195 ctattcaagggtttagaggaggggtggaggaggatgtttggtagtggatttcagatgaggatg 257  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  7682811 ctattcaagggtttagaggaggggtggaggaggatgcttggtagtggatttcagatgaggatg 7682749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 16196117 - 16196356
Alignment:
Q  20 aaatgggttggaaatgccccc--tttgttatgcattccctcaccttttctctttttctactaaaaaagaggctctggtgggggacctttgggccttgaca 117  Q
    ||||||||||||||  |||||  ||||| | |||||||||| | |||||||| ||||||||||| |||||||||  ||||||  ||||| || ||| |||    
T  16196117 aaatgggttggaaactccccccatttgtgaggcattccctctcattttctctctttctactaaataagaggctccagtggggagccttttggtcttaaca 16196216  T
Q  118 ga--------cggtgtggggggatggtcgtttgtttggaggagataacctttcaattggggaaaggattta---aa--agttgttagatactattcaagg 204  Q
    ||         || | |||||||| ||||||||||| | |||||| ||||||||| |||| | |||| |||   ||  ||| ||| |  ||| |||||||    
T  16196217 gaggttggggggggggggggggattgtcgtttgtttaggggagattacctttcaaatgggaagaggacttacttaatgagtggtttgtcactcttcaagg 16196316  T
Q  205 gtttagaggaggggtggaggaggatgtttggtagtggatt 244  Q
    |||||||||||||||||| ||||||| ||||  |||||||    
T  16196317 gtttagaggaggggtggatgaggatgcttggcggtggatt 16196356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University