View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17959_low_27 (Length: 283)

Name: NF17959_low_27
Description: NF17959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17959_low_27
NF17959_low_27
[»] chr4 (1 HSPs)
chr4 (26-168)||(8169833-8169975)


Alignment Details
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 26 - 168
Target Start/End: Complemental strand, 8169975 - 8169833
Alignment:
Q  26 gtagagtatctcgatgatgctggaatctaagatcttgtcttaattttcctattaatcaaattaattaatctactaatccaagttttttcccgaaagtatc 125  Q
    |||||||||||||||||||||||||||||||||||  ||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||    
T  8169975 gtagagtatctcgatgatgctggaatctaagatctgatctgaattttcctattaatcaaattaattaatctagtaatccaagttttttccggaaagtatc 8169876  T
Q  126 taatgatctaagctaacacgatttaaataatttcatttgacac 168  Q
    || |||| |||||||| |  ||  |||||||||||||||||||    
T  8169875 tagtgatttaagctaaaataatgcaaataatttcatttgacac 8169833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University