View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17956_high_26 (Length: 202)

Name: NF17956_high_26
Description: NF17956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17956_high_26
NF17956_high_26
[»] chr5 (2 HSPs)
chr5 (1-67)||(35520879-35520945)
chr5 (100-160)||(35520944-35521004)


Alignment Details
Target: chr5 (Bit Score: 55; Significance: 8e-23; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 35520879 - 35520945
Alignment:
Q  1 atatactttttggttatatttcatcgtagtaattcttagcattgaattatcttccgttgccttgaat 67  Q
    |||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||    
T  35520879 atatacttattggttatatttcatcgtaataattcttagcattgagttatcttccgttgccttgaat 35520945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 35520944 - 35521004
Alignment:
Q  100 atattatacttttcaacttatcacgttcctcttgtcnnnnnnntaaattcattatctataa 160  Q
    ||||||||||||||||||||||||||||||||||||       ||||||||||||||||||    
T  35520944 atattatacttttcaacttatcacgttcctcttgtcaaaaaaataaattcattatctataa 35521004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University