View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17952_low_20 (Length: 309)

Name: NF17952_low_20
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17952_low_20
NF17952_low_20
[»] chr2 (2 HSPs)
chr2 (18-110)||(11173975-11174068)
chr2 (227-302)||(11173767-11173842)


Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 11174068 - 11173975
Alignment:
Q  18 gtttaatatcgtgaatgtttgcataatattgcaaacaatgtggcgccaatttgtatattttgtggtaaacgacttgcataatc-ttggttgagc 110  Q
    |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  11174068 gtttaatatcatgaatgtttgcatgatattgcaaacaatgtggcgccaatttgtatattttgtggtaaacgacttgcataatctttggttgagc 11173975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 227 - 302
Target Start/End: Complemental strand, 11173842 - 11173767
Alignment:
Q  227 gacggaaatggatcgtctcaattgtacttcacttgtcttttctcaaattataatcacaaccattacgattcttctc 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11173842 gacggaaatggatcgtctcaattgtacttcacttgtcttttctcaaattataatcacaaccattacgattcttctc 11173767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University