View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17952_high_34 (Length: 210)

Name: NF17952_high_34
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17952_high_34
NF17952_high_34
[»] chr7 (1 HSPs)
chr7 (1-209)||(39600915-39601129)


Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 39600915 - 39601129
Alignment:
Q  1 cttcaagtgctggtggtggtggtgtttccgggtgttggcatggtagcgagagtgaaagtgtacgtccccatattgtccattcgggtggagattgatcaag 100  Q
    |||||||||  ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39600915 cttcaagtggcggtggtggtggtgtttccgggtgttggtatggtagcgagagtgaaagtgtacgtccccatattgtccattcgggtggagattgatcaag 39601014  T
Q  101 tgt------cggcggcggcatggttggtggtgtttccggttgttggtatggccatgcaagtgaaagtgtacgcccccatgctctatgaatatctcttatg 194  Q
    |||      |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |    
T  39601015 tgtcggtggcggcggcggcatggttggtggtgtttccggttgttggtatggcggtgcaagtgaaagtgtacgcccccatgctctatgaatatctcttaag 39601114  T
Q  195 ttttccattcatttc 209  Q
    |||||||||| ||||    
T  39601115 ttttccattcttttc 39601129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University