View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17952_high_22 (Length: 293)

Name: NF17952_high_22
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17952_high_22
NF17952_high_22
[»] chr2 (1 HSPs)
chr2 (121-276)||(4283814-4283969)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 121 - 276
Target Start/End: Original strand, 4283814 - 4283969
Alignment:
Q  121 atataattgtaacatctgtcttttaatgctgttgagtggagcggtaacatggtgtcatatttgtatcaaattgacggacaatatattgaatgaccaaatt 220  Q
    ||||| ||| |||||||||||||| ||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4283814 atatagttgcaacatctgtctttttattttgttgagtggagcggtaacatggtgtcatatttgtatcaaattgacggacaatatattgaatgaccaaatt 4283913  T
Q  221 aattaatactactgttagtaagttgtcaaattgagtatagtaaataactttggcag 276  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4283914 aattaatactactgttagtaagttgtcaaattgagtatagtaaataactttggcag 4283969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University