View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17947_high_21 (Length: 238)

Name: NF17947_high_21
Description: NF17947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17947_high_21
NF17947_high_21
[»] chr5 (2 HSPs)
chr5 (18-238)||(6858318-6858543)
chr5 (26-91)||(6887529-6887594)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 6858543 - 6858318
Alignment:
Q  18 gattgttcattgtgattgctggttgaggattgtcgatttcagttcgatttcgtttttgtagaggaggcattgatgatgatgatataagcttaggttttga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6858543 gattgttcattgtgattgctggttgaggattgtcgatttcagttcgatttcgtttttgtagaggaggcattgatgatgatgatataagcttaggttttga 6858444  T
Q  118 agtgtgaaatggacagtgagacttcaacggtcgagttcagtgagtgggtttgatatggaatttcgaagtggagggagact------gtgggagggaagag 211  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||       |||||||||||||    
T  6858443 agtgtgaaatggacagtgagacttcaacggtcaagttcagtgagtgggtttgatatggaatttcgaagtgga-ggagactatggtaatgggagggaagag 6858345  T
Q  212 agaatgtccaaaattaatggacttggt 238  Q
    |||||||||||||||||||| ||||||    
T  6858344 agaatgtccaaaattaatggccttggt 6858318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 6887594 - 6887529
Alignment:
Q  26 attgtgattgctggttgaggattgtcgatttcagttcgatttcgtttttgtagaggaggcattgat 91  Q
    ||||||||||| | |||| ||||||||||||||| |||||||||||| ||||||||||||||||||    
T  6887594 attgtgattgcagattgaagattgtcgatttcagatcgatttcgtttctgtagaggaggcattgat 6887529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University