View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17945_low_51 (Length: 202)

Name: NF17945_low_51
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17945_low_51
NF17945_low_51
[»] chr5 (1 HSPs)
chr5 (20-182)||(40042664-40042826)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 182
Target Start/End: Complemental strand, 40042826 - 40042664
Alignment:
Q  20 accgcttcctacgaggcgttatcggcactagttttggctatgctggactagaaacattagttccaaagttatgcaactttgttaaattgtatttatctaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40042826 accgcttcctacgaggcgttatcggcactagttttggctatgctggactagaaacattagttccaaagttatgcaactttgttaaattgtatttatctaa 40042727  T
Q  120 aaactggcaaggtcaagaagagattagtctctaccgctcgacgaaagttcttacatttagcat 182  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40042726 aaactggcaaggtcaagaagagattagtctctaccgctcgacgaaagttcttacatttagcat 40042664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University